Кс113А характеристики: КС113А металл, Стабилитрон низковольтный малой мощности, 1.3В, Россия

Содержание

Параметры, цоколевка и аналоги стабилитрона КС113А

Описание стабилитрона КС113А

Стабилитрон КС113А кремниевый, диффузионно-сплавный, малой мощности.
Предназначен для применения в стабилизаторах напряжения и в качестве термокомпенсирующих элементов.
Выпускается в металлостеклянном корпусе с гибкими выводами.
Тип стабилитрона приводится на корпусе.
Корпус стабилитрона в рабочем режиме служит отрицательным электродом (катодом).
Масса стабилитрона не более 1 г.

Размеры стабилитрона КС113А

Характеристики стабилитрона КС113А

Номинальное напряжение стабилизации стабилитрона 1,3 В
Номинальный ток стабилизации стабилитрона 10,0 мА
Максимально-допустимая рассеиваемая мощность на стабилитроне 200 мВт
Минимальное напряжение стабилизации стабилитрона 1,17 В
Максимальное напряжение стабилизации стабилитрона 1,43 В
Дифференциальное сопротивление стабилитрона 12 Ом
Температурный коэффициент стабилизации стабилитрона -42 10-2 %/°С
Минимальный ток стабилизации стабилитрона 1,0 мА
Максимальный ток стабилизации стабилитрона 100 мА
Максимально-допустимая температура корпуса стабилитрона 125 °С

Стабисторы типа: 2С113А, КС113А, 2С119А, КС119А

Все картинки в новостях кликабельные, то есть при нажатии они увеличиваются.

Стабисторы кремниевые диффузионно-сплавные: 2С113А, КС113А, 2С119А, КС119А. Предназначены для работы в стабилизаторах напряжения и в качестве термокомпенсирующих элементов. Выпускаются в металлостеклянном корпусе с гибкими выводами.

Масса стабистора не более 1 грамма.

Чертёж стабистора 2С113А, КС113А, 2С119А, КС119А

Электрические параметры стабистора 2С113А, КС113А, 2С119А, КС119А.

Напряжение стабилизации номинальное при 24,85°С, Iст=10 мА
2С113А, КС113А 1,3 В
2С119А, КС119А 1,9 В
Разброс напряжения стабилизации при Iст=10 мА
при 24,85°С ±10%
при -60,15°С
2С113А От 1,17 до 1,8 В
2С119А От 1,71 до 2,6 В
при 124,85°С
2С113А От 0,72 до 1,43 В
2С119А От 1,16 до 2,09 В
Средний температурный коэффициент напряжения стабилизации при температуре
от -60,15 до 124,85°С
2С113А, 2С119А От -0,42 до -0,2%/К
КС113А, не хуже -0,3%/К
КС119А, не хуже -0,4%/К
от 49,85 до 124,85°С
2С113А От -0,42 до -0,31%/К
2С119А От -0,42 до 0,3%/К
Временна́я нестабильность напряжения стабилизации
для 2С113А, 2С119А
±3,5%
Постоянный обратный ток при 24,85°С, Uобр=1 В
для 2С113А, 2С119А, не более
0,1 мкА
Дифференциальное сопротивление, не более
при 24,85°С, Iст=1 мА
2С113А 80 Ом
2С119А 130 Ом
при 24,85°С, Iст=10 мА
2С113А, КС113А 12 Ом
2С119А, КС119А 15 Ом
при -60,15°С, Iст=10 мА
2С113А 12 Ом
2С119А 15 Ом
при 124,85°С, Iст=10 мА  
2С113А 18 Ом
2С119А 25 Ом

Предельные эксплуатационные данные 2С113А, КС113А, 2С119А, КС119А.

Минимальный ток стабилизации 1 мА
Максимальный постоянный ток стабилизации 100 мА
Импульсный прямой ток при Iпр,ср≤50 мА, τи≤100мкс, для 2С113А, 2С119А, КС119А 200 мА
Постоянное обратное напряжение при переходных процессах для 2С113А, 2С119А 1 В
Рассеиваемая мощность
2С113А 180 мВт
2С119А 260 мВт
Температура окружающей среды От -60,15 до 124,85°С
Температура перехода 2С113А, 2С119А 124,85°С

Зависимость дифференциального сопротивления от тока

Зависимость дифференциального сопротивления от тока.

Зависимость среднего температурного коэффициента напряжения стабилизации от тока и зависимость напряжения стабилизации от температуры

Зависимость среднего температурного коэффициента напряжения стабилизации от тока и зависимость напряжения стабилизации от температуры.


Стабилитрон КС113А

Количество драгоценных металлов в стабилитроне КС113А согласно документации производителя. Справочник массы и наименований ценных металлов в советских стабилитронах КС113А.

Стабилитрон КС113А количество содержания драгоценных металлов:
Золото: 0,00064 грамм.
Серебро: 0 грамм.
Платина: 0 грамм.
Палладий: 0 грамм.
Согласно данным: Из справочника Связь-Инвест.

Справочник содержания ценных металлов из другого источника:

Стабилитроны КС113А теория

Полупроводниковый стабилитрон, или диод Зенера — полупроводниковый диод, работающий при обратном смещении в режиме пробоя. До наступления пробоя через стабилитрон протекают незначительные токи утечки, а его сопротивление весьма высоко. При наступлении пробоя ток через стабилитрон резко возрастает, а его дифференциальное сопротивление падает до величины, составляющей для различных приборов от долей Ома до сотен Ом. Поэтому в режиме пробоя напряжение на стабилитроне поддерживается с заданной точностью в широком диапазоне обратных токов.

 

Прежде всего, не следует забывать, что стабилитрон работает только в цепях постоянного тока. Напряжение на стабилитрон подают в обратной полярности, то есть на анод стабилитрона будет подан минус “-“. При таком включении стабилитрона через него протекает обратный ток (I обр) от выпрямителя. Напряжение с выхода выпрямителя может изменяться, будет изменяться и обратный ток, а напряжение на стабилитроне и на нагрузке останется неизменным, то есть стабильным. На следующем рисунке показана вольт-амперная характеристика стабилитрона.

Основное назначение стабилитронов — стабилизация напряжения. Серийные стабилитроны изготавливаются на напряжения от 1,8 В до 400 В. Интегральные стабилитроны со скрытой структурой на напряжение около 7 В являются самыми точными и стабильными твердотельными источниками опорного напряжения: лучшие их образцы приближаются по совокупности показателей к нормальному элементу Вестона. Особый тип стабилитронов, высоковольтные лавинные диоды («подавители переходных импульсных помех», «суппрессоры», «TVS-диоды») применяется для защиты электроаппаратуры от перенапряжений.

Стабилитроны КС113А Принцип действия

Советские и импортные стабилитроны

Полупроводниковый стабилитрон — это диод, предназначенный для работы в режиме пробоя на обратной ветви вольт-амперной характеристики. В диоде, к которому приложено обратное, или запирающее, напряжение, возможны три механизма пробоя: туннельный пробой, лавинный пробой и пробой вследствие тепловой неустойчивости — разрушительного саморазогрева токами утечки. Тепловой пробой наблюдается в выпрямительных диодах, особенно германиевых, а для кремниевых стабилитронов он не критичен. Стабилитроны проектируются и изготавливаются таким образом, что либо туннельный, либо лавинный пробой, либо оба эти явления вместе возникают задолго до того, как в кристалле диода возникнут предпосылки к тепловому пробою. Серийные стабилитроны изготавливаются из кремния, известны также перспективные разработки стабилитронов из карбида кремния и арсенида галлия.

Первую модель электрического пробоя предложил в 1933 году Кларенс Зенер, в то время работавший в Бристольском университете. Его «Теория электического пробоя в твёрдых диэлектриках» была опубликована летом 1934 года. В 1954 году Кеннет Маккей из Bell Labs установил, что предложеный Зенером туннельный механизм действует только при напряжениях пробоя до примерно 5,5 В, а при бо́льших напряжениях преобладает лавинный механизм. Напряжение пробоя стабилитрона определяется концентрациями акцепторов и доноров и профилем легирования области p-n-перехода. Чем выше концентрации примесей и чем больше их градиент в переходе, тем больше напряжённость электрического поля в области пространственного заряда при равном обратном напряжении, и тем меньше обратное напряжение, при котором возникает пробой:

Туннельный, или зенеровский, пробой возникает в полупроводнике только тогда, когда напряжённость электрического поля в p-n-переходе достигает уровня в 106 В/см. Такие уровни напряжённости возможны только в высоколегированных диодах (структурах p+-n+-типа проводимости) с напряжением пробоя не более шестикратной ширины запрещённой зоны (6 EG ≈ 6,7 В), при этом в диапазоне от 4 EG до 6 EG (4,5…6,7 В) туннельный пробой сосуществует с лавинным, а при напряжении пробоя менее 4 EG (≈4,5 В) полностью вытесняет его. С ростом температуры перехода ширина запрещённой зоны, а вместе с ней и напряжение пробоя, уменьшается: низковольтные стабилитроны с преобладанием туннельного пробоя имеют отрицательный температурный коэффициент напряжения (ТКН).

В диодах с меньшими уровнями легирования, или меньшими градиентами легирующих примесей, и, как следствие, бо́льшими напряжениями пробоя наблюдается лавинный механизм пробоя. Он возникает при концентрациях примесей, примерно соответствующих напряжению пробоя в 4 EG (≈4,5 В), а при напряжениях пробоя выше 4 EG (≈7,2 В) полностью вытесняет туннельный механизм. Напряжение, при котором возникает лавинный пробой, с ростом температуры возрастает, а наибольшая величина ТКН пробоя наблюдается в низколегированных, относительно высоковольтных, переходах.

Механизм пробоя конкретного образца можно определить грубо — по напряжению стабилизации, и точно — по знаку его температурного коэффициента. В «серой зоне» (см. рисунок), в которой конкурируют оба механизма пробоя, ТКН может быть определён только опытным путём. Источники расходятся в точных оценках ширины этой зоны: С. М. Зи указывает «от 4 EG до 6 EG» (4,5…6,7 В), авторы словаря «Электроника» — «от 5 до 7 В»8, Линден Харрисон — «от 3 до 8 В»26, Ирвинг Готтлиб проводит верхнюю границу по уровню 10 В9. Низковольтные лавинные диоды (LVA) на напряжения от 4 до 10 В — исключение из правила: в них действует только лавинный механизм.

Оптимальная совокупность характеристик стабилитрона достигается в середине «серой зоны», при напряжении стабилизации около 6 В. Дело не столько в том, что благодаря взаимной компенсации ТКН туннельного и лавинного механизмов эти стабилитроны относительно термостабильны, а в том, что они имеют наименьший технологический разброс напряжения стабилизации и наименьшее, при прочих равных условиях, дифференциальное сопротивление. Наихудшая совокупность характеристик — высокий уровень шума, большой разброс напряжений стабилизации, высокое дифференциальное сопротивление — свойственна низковольтным стабилитронам на 3,3—4,7 В.


Область применения стабилитрона КС113А

Основная область применения стабилитрона — стабилизация постоянного напряжения источников питания. В простейшей схеме линейного параметрического стабилизатора стабилитрон выступает одновременно и источником опорного напряжения, и силовым регулирующим элементом. В более сложных схемах стабилитрону отводится только функция источника опорного напряжения, а регулирующим элементом служит внешний силовой транзистор.

Прецизионные термокомпенсированные стабилитроны и стабилитроны со скрытой структурой широко применяются в качестве дискретных и интегральных источников опорного напряжения (ИОН), в том числе в наиболее требовательных к стабильности напряжения схемах измерительных аналого-цифровых преобразователей. C середины 1970-х годов и по сей день (2012 год) стабилитроны со скрытой структурой являются наиболее точными и стабильными твердотельными ИОН. Точностные показатели лабораторных эталонов напряжения на специально отобранных интегральных стабилитронах приближаются к показателям нормального элемента Вестона.

Особые импульсные лавинные стабилитроны («подавители переходных импульсных помех», «суппрессоры», «TVS-диоды») применяются для защиты электроаппаратуры от перенапряжений, вызываемых разрядами молний и статического электричества, а также от выбросов напряжения на индуктивных нагрузках. Такие приборы номинальной мощностью 1 Вт выдерживают импульсы тока в десятки и сотни ампер намного лучше, чем «обычные» пятидесятиваттные силовые стабилитроны. Для защиты входов электроизмерительных приборов и затворов полевых транзисторов используются обычные маломощные стабилитроны. В современных «умных» МДП-транзисторах защитные стабилитроны выполняются на одном кристалле с силовым транзистором.

Маркировка стабилитронов КС113А

Маркировка стабилитронов

 

Есть информация о стабилитроне КС113А – высылайте ее нам, мы ее разместим на этом сайте посвященному утилизации, аффинажу и переработке драгоценных и ценных металлов.

Фото Стабилитрон КС113А:

Предназначение Стабилитрон КС113А.

Характеристики Стабилитрон КС113А:

Купить или продать а также цены на Стабилитрон КС113А (стоимость, купить, продать):

Отзыв о стабилитроне КС113А вы можете в комментариях ниже:

КС113А Стабилитрон 1,3V (1,17… 1,43 V) корпус КД8, цена 4.21 грн

КС113А
Стабисторы КС113А кремниевые, диффузионно-сплавные, малой мощности. 
Предназначены для применения в стабилизаторах напряжения и в качестве термокомпенсирующих элементов. 
Выпускаются в металлостеклянном корпусе с гибкими выводами. 
Тип стабистора приводится на корпусе. 
Корпус стабистора в рабочем режиме служит отрицательным электродом (катодом).
Масса стабистора не более 1 г.
Технические условия: аА0.336.108 ТУ.

Основные технические параметры стабистора КС113А:
• Номинальное напряжение стабилизации: 1,3 В при Iст 10 мА;
• Разброс напряжения стабилизации: 1,17… 1,43 В;
• Температурный коэффициент напряжения стабилизации: -0,42 %/°С;
• Временная нестабильность напряжения стабилизации: ±3,5 %;
• Дифференциальное сопротивление: 15 Ом при Iст 7,5 мА;
• Максимально допустимый ток стабилизации: 100 мА;
• Максимально-допустимая рассеиваемая мощность: 0,18 Вт;
• Рабочий интервал температуры окружающей среды: -60… +125 °С

Технические характеристики стабисторов 2С113А, КС113А:

Тип стабистора Uст. αUст. rст. Iст. Рmax Тк.max (Тп.) Т окр.
мин ном макс Iст.ном. мин макс
В В В мА %/С Ом мА мА Вт °С °С
2С113А 1,17 1,3 1,43 10 -0,42…-0,2 12 1 100 0,16 125 -60… +125
КС113А 1,17 1,3 1,43 10 -0,42 12 1 100 0,18 125 -60… +125


Условные обозначения электрических параметров стабисторов:

 

  • Uст. — напряжение стабилизации стабистора;
  • αUст. — температурный коэффициент напряжения стабилизации стабистора;
  • rст. — дифференциальное сопротивление стабистора;
  • Iст. — ток стабилизации стабистора;
  • Рmax — рассеиваемая мощность стабистора;
  • Тк. мах — максимально-допустимая температура корпуса стабистора;
  • Тп. мах — максимально-допустимая температура перехода стабистора;
  • Т окр. — температура окружающей среды.

Покупаем на выгодных условиях: платы, радиодетали, микросхемы, АТС, приборы, лом электроники, катализаторы

Мы гарантируем Вам честные цены! Серьезный подход и добропорядочность — наше главное кредо.

Компания ООО «РадиоСкупка» (скупка радиодеталей) закупает и продает радиодетали , а также любое радиотехническое оборудование и приборы. У нас Вы сможете найти не только наиболее востребованные радиодетали, но и редкие производства СССР и стран СЭВ. Мы являемся партнером  «ФГУП НИИ Радиотехники» и накопили огромный опыт  за наши годы работы. Также многих радиолюбителей заинтересует наш уникальный справочник по содержанию драгметаллов в радиодеталях. В левом нижнем углу нашего сайта Вы сможете узнать актуальные цены на драгметаллы такие, как золото, серебро, платина, палладий (цены указаны в $ за унцию) а также текущие курсы основных валют. Работаем со всеми  городами России и география нашей работы простирается от Пскова и до Владивостока. Наш квалифицированный персонал произведет грамотную и выгодную для Вас оценку вашего оборудования, даст профессиональную консультацию любым удобным Вам способом – по почте или телефону.  Наш клиент всегда доволен!

Покупаем платы, радиодетали, приборы, АТС, катализаторы. Заинтересованы в выкупе складов с неликвидными остатками радиодеталей а также цехов под ликвидацию с оборудованием КИПиА.

Приобретаем:

  • платы от приборов, компьютеров
  • платы от телевизионной и бытовой техники
  • микросхемы любые
  • транзисторы
  • конденсаторы
  • разъёмы
  • реле
  • переключатели
  • катализаторы автомобильные и промышленные
  • приборы (самописцы, осциллографы, генераторы, измерители и др.)

Купим Ваши радиодетали и приборы в любом состоянии, а не только новые. Цены на сайте указаны на новые детали. Расчет стоимости б/у деталей осуществляется индивидуально в зависимости от года выпуска, состоянии, а также текущих цен Лондонской биржи металлов. Работаем почтой России, а также транспортными компаниями. Наша курьерская служба встретит и заберет Ваш груз с попутного автобуса или поезда.

Честные цены, наличный и безналичный расчет, порядочность и клиентоориентированность наше главное преимущество!

Остались вопросы – звоните 8-961-629-5257, наши менеджеры с удовольствием ответят на все Ваши вопросы. Для вопросов по посылкам: 8-900-491-6775. Почта [email protected]

С уважением, директор Александр Михайлов.

Примеры стабисторов

  • КС107А — Uст = 0,7 В

  • КС113А — Uст = 1,3 В

  • КС119А — Uст = 1,9 В

  • Д220С — Uст = 0,59 В

ВАХ стабистора:

Двуханодный стабилитрон – выполнен в виде двух встречно включенных стабилитроном, таким образом.

УГО двуханодного стабилитрона.

Фотодиоды и светодиоды

Фотодиоды. Фотодиодом называется фотогальванический приёмник излучения, светочувствительный элемент которого представляют собой структуру полупроводникового диода без внутреннего усиления.

Принцип действия. При облучении полупроводника световым потоком Ф возрастает фотогенерация собственных носителей зарядов, что приводит к увеличению количества как основных, так и неосновных носителей зарядов.

Фотогенерация в значительной степени будет влиять на обратный ток (см. рисунок ниже.)

Для фотодиодов Iобр – это фототок. Зависимость фототока Iф от величины светового потока Iф=f(Ф)

Спектральная характеристика – это зависимость фототока от длины волны светового излучения Iф=f(λ).

Темновой ток – ток через фотодиод при отсутствии светового потока и при заданном рабочем напряжении.

Интегральная чувствительность – это отношение фототока к световому потоку

Рабочее напряжение – это обратное напряжение, подаваемое на фотодиод, при котором все параметры фотодиода будут оптимальными.

Схема включения фотодиода:

Фотодиод может работать в двух режимах:

При освещении фотодиода в фотогальваническом режиме на его контактах появляется напряжение.

При освещении фотодиода в фотодиодном режиме изменяется его обратный ток, который можно регистрировать при помощи преобразователя ток-напряжение:

А вот схема без операционного усилителя:

Светодиоды. Светодиодом называется полупроводниковый прибор, в котором происходит непосредственное преобразование электрической энергии в энергию светового излучения.

Принцип действия. При прямом включении основные носители заряда переходят через p-n переход и там рекомбинируют. Рекомбинация связана с выделением энергии. Для большинства полупроводниковых материалов это энергия тепловая. Только для некоторых типов на основе арсенида галлия ширина запрещённой зоны ΔW достаточно велика, и длина волны лежит в видимой части спектра.

Основные характеристики:

а) Яркостная характеристика – это мощностная зависимость излучения от прямого тока

Pu=f(Iпр).

Спектральная характеристика – это зависимость мощности излучения от длины волны Pu=f(λ).

Оптроны

Оптрон (оптопара) — электронный прибор, состоящий из излучателя света (обычно — светодиод) и фотоприёмника (биполярных и полевых фототранзисторов, фотодиодов фоторезисторов), связанных оптическим каналом и как правило объединённых в общем корпусе. Принцип работы оптрона заключается в преобразовании электрического сигнала в свет, его передаче по оптическому каналу и последующем преобразовании обратно в электрический сигнал.

Оптроны обычно используются для гальванической развязки цепей, измерения расстояния и скорости.

Схема гальванической развязки с помощью оптрона:

КРЕН12А характеристики микросхемы: схема подключения, распиновка КР142ЕН12А

В статье рассмотрены характеристики КРЕН12A (полная маркировка КР142ЕН12А) и схема её подключения. Данное полупроводниковое устройство представляет собой регулируемый стабилизатор положительного напряжения питания для электроприборов работающих от 1,25-37 В с током потребления до 1,5 А. Она оснащена необходимой внутренней защитой транзистора на выходе, перегрузок по току и перегрева. Для получения необходимых выходных параметров необходима дополнительная электронная обвязка, состоящая всего из двух резисторов.

Основные параметры

Характеристики КРЕН12A, приведённые в технических описаниях (datasheet), стоит рассматривать с учётом максимальной рассеиваемой мощности устройства. В любых режимах работы не допускается её превышение, а для стабильной работы необходимо предусмотреть соответствующее охлаждение. Без использования радиатора предельная мощность ограничивается параметрами корпуса — обычно не превышает 1 Вт. Напряжение на входе микросхемы должно быть всегда больше, чем на выходе на 2-3 В.

Максимальные параметры

Приведём максимальные значения параметров для КРЕН12A:

  • напряжение: на входе до 40 В; на выходе от 1.25 до 37 В;
  • выходной ток 1.5 А;
  • рассеиваемая мощность до 20 Вт;
  • диапазон рабочих температур от 0 до +125 oC.

Не допускается превышать указанные значения.

Аналоги

У КРЕН12А есть отличные функциональные аналоги КР142ЕН12Б (до 1 А) и LM317T. Импортный по некоторым параметрам считается лучше отечественного. Возможно в связи с этим белорусский «Интеграл» в последнее время выпускает подобные устройства и с маркировкой «LM». Это обусловлено большой популярностью линейных стабилизаторов напряжения в мире, поэтому зарубежные производители все время совершенствуют их.

Регулировка напряжения

Вместо одного из двух резисторов можно использовать потенциометр к КР142ЕН12А и получить схему включения с регулировкой. C его помощью на выходе микросхемы добиваются необходимого напряжения. Таким образом, в домашних условиях, можно сделать простейший регулируемый стабилизатор постоянного электропитания.

На рисунке ниже представлена упрощённая схема включения крен12а для стабилизации 12V. При таком подключении ток в нагрузке ограничен максимальными параметрами микросхемы и не превышает 1 А. Рассеиваемая мощность определяется площадью радиатора — чем она больше, тем лучше.

В данной схеме для понижения выходного напряжения сопротивление R2 уменьшают. И наоборот, для повышения – увеличивают R2. Минимальное возможное значение R2 составляет 1 Ом (1.25 В), а максимальное теоретически — до 6.2 кОм (35 В).

Конечно, для полноценного регулируемого блока питания (БП) указанных компонентов будет недостаточно. Например, для подключения от сети 220 В необходимы еще трансформатор, выпрямительный диодный мост и сглаживающие конденсаторы. Упрощенную схему БП можно скачать по следующей


или


— более продвинутая конструкция БП с возможностью получения фиксированных напряжений.

Для повышения тока в нагрузке на выходе микросхемы устанавливают мощные транзисторы, однако есть еще возможность параллельного включения.

Стабилизированный регулируемый блок питания с защитой от перегрузок

Множество радиолюбительских блоков питания (БП) выполнено на микросхемах КР142ЕН12, КР142ЕН22А, КР142ЕН24 и т.п. Нижний предел регулировки этих микросхем составляет 1,2…1,3 В, но иногда необходимо напряжение 0,5…1 В. Автор предлагает несколько технических решений БП на базе данных микросхем.

Интегральная микросхема (ИМС) КР142ЕН12А (рис.1) представляет собой регулируемый стабилизатор напряжения компенсационного типа в корпусе КТ-28-2, который позволяет питать устройства током до 1,5 А в диапазоне напряжений 1,2…37 В. Этот интегральный стабилизатор имеет термостабильную защиту по току и защиту выхода от короткого замыкания.

Рис.1. ИМС КР142ЕН12А

На основе ИМС КР142ЕН12А можно построить регулируемый блок питания, схема которого (без трансформатора и диодного моста) показана на рис.2. Выпрямленное входное напряжение подается с диодного моста на конденсатор С1. Транзистор VT2 и микросхема DA1 должны располагаться на радиаторе. Теплоотводящий фланец DA1 электрически соединен с выводом 2, поэтому если DA1 и транзистор VD2 расположены на одном радиаторе, то их нужно изолировать друг от друга. В авторском варианте DA1 установлена на отдельном небольшом радиаторе, который гальванически не связан с радиатором и транзистором VT2.


Рис.2. Регулируемый БП на ИМС КР142ЕН12А

Мощность, рассеиваемая микросхемой с теплоотводом, не должна превышать 10 Вт. Резисторы R3 и R5 образуют делитель напряжения, входящий в измерительный элемент стабилизатора, и подбираются согласно формуле: Uвых = Uвых.min ( 1 + R3/R5 ).

На конденсатор С2 и резистор R2 (служит для подбора термостабильной точки VD1) подается стабилизированное отрицательное напряжение -5 В. В авторском варианте напряжение подается от диодного моста КЦ407А и стабилизатора 79L05, питающихся от отдельной обмотки силового трансформатора.

Для защиты от замыкания выходной цепи стабилизатора достаточно подключить параллельно резистору R3 электролитический конденсатор емкостью не менее 10 мкФ, а резистор R5 зашунтировать диодом КД521А. Расположение деталей некритично, но для хорошей температурной стабильности необходимо применить соответствующие типы резисторов. Их надо располагать как можно дальше от источников тепла. Общая стабильность выходного напряжения складывается из многих факторов и обычно не превышает 0,25% после прогрева.

После включения и прогрева устройства минимальное выходное напряжение 0 В устанавливают резистором Rдоб. Резисторы R2 (рис.2) и резистор Rдоб (рис.3) должны быть многооборотными подстроечными из серии СП5.

Рис.3. Схема включения Rдоб

Возможности по току у микросхемы КР142ЕН12А ограничены 1,5 А. В настоящее время в продаже имеются микросхемы с аналогичными параметрами, но рассчитанные на больший ток в нагрузке, например LM350 — на ток 3 A, LM338 — на ток 5 А. Данные по этим микросхемам можно найти на сайте National Semiconductor [1].

В последнее время в продаже появились импортные микросхемы из серии LOW DROP (SD, DV, LT1083/1084/1085). Эти микросхемы могут работать при пониженном напряжении между входом и выходом (до 1…1,3 В) и обеспечивают на выходе стабилизированное напряжение в диапазоне 1,25…30 В при токе в нагрузке 7,5/5/3 А соответственно. Ближайший по параметрам отечественный аналог типа КР142ЕН22 имеет максимальный ток стабилизации 7,5 А.

При максимальном выходном токе режим стабилизации гарантируется производителем при напряжении вход-выход не менее 1,5 В. Микросхемы также имеют встроенную защиту от превышения тока в нагрузке допустимой величины и тепловую защиту от перегрева корпуса.

Данные стабилизаторы обеспечивают нестабильность выходного напряжения 0,05%/В, нестабильность выходного напряжения при изменении выходного тока от 10 мА до максимального значения не хуже 0,1 %/В.

На рис.4 показана схема БП для домашней лаборатории, позволяющая обойтись без транзисторов VT1 и VT2, показанных на рис.2. Вместо микросхемы DA1 КР142ЕН12А применена микросхема КР142ЕН22А. Это регулируемый стабилизатор с малым падением напряжения, позволяющий получить в нагрузке ток до 7,5 А.


Рис.4. Регулируемый БП на ИМС КР142ЕН22А

Максимально рассеиваемую мощность на выходе стабилизатора Рmax можно рассчитать по формуле: Рmax = (Uвх — Uвых) Iвых , где Uвх — входное напряжение, подаваемое на микросхему DA3, Uвых — выходное напряжение на нагрузке, Iвых — выходной ток микросхемы.

Например, входное напряжение, подаваемое на микросхему, Uвх=39 В, выходное напряжение на нагрузке Uвых=30 В, ток на нагрузке Iвых=5 А, тогда максимальная рассеиваемая микросхемой мощность на нагрузке составляет 45 Вт.

Электролитический конденсатор С7 применяется для снижения выходного импеданса на высоких частотах, а также понижает уровень напряжения шумов и улучшает сглаживание пульсаций. Если этот конденсатор танталовый, то его номинальная емкость должна быть не менее 22 мкФ, если алюминиевый — не менее 150 мкФ. При необходимости емкость конденсатора С7 можно увеличить.

Если электролитический конденсатор С7 расположен на расстоянии более 155 мм и соединен с БП проводом сечением менее 1 мм, тогда на плате параллельно конденсатору С7, ближе к самой микросхеме, устанавливают дополнительный электролитический конденсатор емкостью не менее 10 мкФ.

Емкость конденсатора фильтра С1 можно определить приближенно, из расчета 2000 мкФ на 1 А выходного тока (при напряжении не менее 50 В). Для снижения температурного дрейфа выходного напряжения резистор R8 должен быть либо проволочный, либо металло-фольгированный с погрешностью не хуже 1 %. Резистор R7 того же типа, что и R8. Если стабилитрона КС113А в наличии нет, можно применить узел, показанный на рис.3. Схемное решение защиты, приведенное в [2], автора вполне устраивает, так как работает безотказно и проверено на практике. Можно использовать любые схемные решения защиты БП, например предложенные в [3]. В авторском варианте при срабатывании реле К1 замыкаются контакты К1.1, закорачивая резистор R7, и напряжение на выходе БП становится равным 0 В.

Печатная плата БП и расположение элементов показаны на рис.5, внешний вид БП — на рис.6. Размеры печатной платы 112×75 мм. Радиатор выбран игольчатый. Микросхема DA3 изолирована от радиатора прокладкой и прикреплена к нему с помощью стальной пружинящей пластины, прижимающей микросхему к радиатору.


Рис.5. Печатная плата БП и расположение элементов

Конденсатор С1 типа К50-24 составлен из двух параллельно соединенных конденсаторов емкостью 4700 мкФх50 В. Можно применить импортный аналог конденсатора типа К50-6 емкостью 10000 мкФх50 В. Конденсатор должен располагаться как можно ближе к плате, а проводники, соединяющие его с платой, должны быть как можно короче. Конденсатор С7 производства Weston емкостью 1000 мкФх50 В. Конденсатор С8 на схеме не показан, но отверстия на печатной плате под него есть. Можно применить конденсатор номиналом 0,01…0,1 мкФ на напряжение не менее 10…15 В.

Рис.6. Внешний вид БП

Диоды VD1-VD4 представляют собой импортную диодную микросборку RS602, рассчитанную на максимальный ток 6 А (рис.4). В схеме защиты БП применено реле РЭС10 (паспорт РС4524302). В авторском варианте применен резистор R7 типа СПП-ЗА с разбросом параметров не более 5%. Резистор R8 (рис.4) должен иметь разброс от заданного номинала не более 1 %.

Блок питания обычно настройки не требует и начинает работать сразу после сборки. После прогрева блока резистором R6 (рис.4) или резистором Rдоп (рис.3) выставляют 0 В при номинальной величине R7.

В данной конструкции применен силовой трансформатор марки ОСМ-0,1УЗ мощностью 100 Вт. Магнитопровод ШЛ25/40-25. Первичная обмотка содержит 734 витка провода ПЭВ 0,6 мм, обмотка II — 90 витков провода ПЭВ 1,6 мм, обмотка III — 46 витков провода ПЭВ 0,4 мм с отводом от середины.

Диодную сборку RS602 можно заменить диодами, рассчитанными на ток не менее 10 А, например, КД203А, В, Д или КД210 А-Г (если не размещать диоды отдельно, придется переделать печатную плату). В качестве транзистора VT1 можно применить транзистор КТ361Г.

Источники:

  1. https://www.national.com/catalog/AnalogRegulators_LinearRegulators-StandardNPN_PositiveVoltageAdjutable.html
  2. Морохин Л. Лабораторный источник питания//Радио. — 1999 — №2
  3. Нечаев И. Защита малогабаритных сетевых блоков питания от перегрузок//Радио. — 1996.-№12
Список радиоэлементов
ОбозначениеТипНоминалКоличествоПримечаниеМагазинМой блокнот
Регулируемый БП на ИМС КР142ЕН12А
DA1Линейный регуляторLM78L121КР142ЕН12АПоиск в магазине ОтронВ блокнот
VT1Биполярный транзистор КТ814Г1Поиск в магазине ОтронВ блокнот
VT2Биполярный транзистор КТ819Г1Поиск в магазине ОтронВ блокнот
VD1Стабилитрон КС113А1Поиск в магазине ОтронВ блокнот
С1Электролитический конденсатор4700 мкФ 50 В1Поиск в магазине ОтронВ блокнот
С2Конденсатор0.1 мкФ1Поиск в магазине ОтронВ блокнот
С3Электролитический конденсатор47 мкФ 50 В1Поиск в магазине ОтронВ блокнот
R1Резистор 2.2 Ом11 ВтПоиск в магазине ОтронВ блокнот
R2Подстроечный резистор470 Ом1Поиск в магазине ОтронВ блокнот
R3Переменный резистор2.2 кОм1Поиск в магазине ОтронВ блокнот
R4Резистор 240 Ом12 ВтПоиск в магазине ОтронВ блокнот
R5Резистор 91 Ом11 ВтПоиск в магазине ОтронВ блокнот
Схема включения Rдоб
С2Конденсатор0.1 мкФ1Поиск в магазине ОтронВ блокнот
R2Резистор 210 Ом1Поиск в магазине ОтронВ блокнот
R доб.Подстроечный резистор470 Ом1Поиск в магазине ОтронВ блокнот
Регулируемый БП на ИМС КР142ЕН22А
DA1Линейный регулятор LM78051Поиск в магазине ОтронВ блокнот
DA2Линейный регулятор LM79L051Поиск в магазине ОтронВ блокнот
DA3Линейный регулятор LT10831КР142ЕН22АПоиск в магазине ОтронВ блокнот
VT1Биполярный транзистор КТ203А1Поиск в магазине ОтронВ блокнот
VD1-VD4Диодный мост RS6021Поиск в магазине ОтронВ блокнот
VD5-VD8Диодный мост КЦ407А1Поиск в магазине ОтронВ блокнот
VD9, VD10Диод КД522Б2Поиск в магазине ОтронВ блокнот
VD11Стабилитрон КС113А1Поиск в магазине ОтронВ блокнот
VS1ТиристорКУ103Е1Поиск в магазине ОтронВ блокнот
С1Электролитический конденсатор10000 мкФ 50 В1Поиск в магазине ОтронВ блокнот
С2, С3Электролитический конденсатор470 мкФ 25 В2Поиск в магазине ОтронВ блокнот
С4, С5Электролитический конденсатор22 мкФ 16 В2Поиск в магазине ОтронВ блокнот
С6Конденсатор0.1 мкФ1Поиск в магазине ОтронВ блокнот
С7Электролитический конденсатор1000 мкФ 50 В1Поиск в магазине ОтронВ блокнот
R1Резистор 12 кОм1Поиск в магазине ОтронВ блокнот
R2Резистор 0.1 Ом13 ВтПоиск в магазине ОтронВ блокнот
R3Резистор 510 Ом1Поиск в магазине ОтронВ блокнот
R4Резистор 1 кОм1подборПоиск в магазине ОтронВ блокнот
R5Резистор 5.1 кОм10.5 ВтПоиск в магазине ОтронВ блокнот
R6Подстроечный резистор1 кОм1Поиск в магазине ОтронВ блокнот
R7Переменный резистор2.2 кОм1Поиск в магазине ОтронВ блокнот
R8Резистор 91 Ом12 ВтПоиск в магазине ОтронВ блокнот
HL1Светодиод АЛ307Б1Поиск в магазине ОтронВ блокнот
Л1РелеРЭС 101Поиск в магазине ОтронВ блокнот
Т1ТрансформаторОСМ-0.1УЗ1Поиск в магазине ОтронВ блокнот
FU1Предохранитель5 А1Поиск в магазине ОтронВ блокнот
SB1Кнопка1Поиск в магазине ОтронВ блокнот
Добавить все
Теги:

Джорджтаун: Модель Организации Объединенных Наций • Новости • Школа Менло

Спортсмены, занимающиеся зимними видами спорта, при регистрации должны заполнить поле об освобождении от участия в спортивных соревнованиях.

Номер курса: KS113

Название курса: Джорджтаун: Модель Организации Объединенных Наций

Инструкторы: Рошан Чандна ’18, Ребекка Гертмениан, Кэтрин Грей

Что вы узнаете:

Переговоры, дебаты, публичные выступления, мышление и письмо на ходу, совместное решение реальных проблем, действия в качестве гражданина мира, составление хорошо проработанного и эффективного документа с изложением позиции: это лишь некоторые из навыков, которым вы научитесь. поскольку этот курс готовит вас к уверенному участию в NAIMUN, конференции Национальной американской модели Организации Объединенных Наций, организованной Джорджтаунским университетом в Вашингтоне, округ Колумбия.C. Каждый учащийся исследует назначенную страну и вопросы, имеющие отношение к назначенному комитету, напишет статью, в которой отстаивает позицию страны по этим вопросам, и попрактикуется в защите этих позиций как в подготовленных выступлениях, так и в неформальных дебатах. На конференции вы будете произносить речи, формировать союзы и писать резолюции, предлагающие решения реальных проблем, которыми занимается ваш комитет. У нас также будет одно утро с возможностью осмотра достопримечательностей в Вашингтоне!

Дата/местоположение

Виды деятельности

Чтение / Домашнее задание / Подготовка

Понедельник, 13 февраля

Кампус Менло

9:00 — 15:00

9:00-10:00: Что такое ООН и что такое МУН? (видео и лекция)

10:15-10:45: Чтение справочного руководства для назначенного комитета.

10:45–11:30: Как исследовать и написать позиционный документ

11:30–12:00: Игра с публичными выступлениями.

13:00–15:00: Пробное заседание комитета (парламентские процедуры, практика выступлений и дебатов, как написать резолюцию)

Работа над установочным листом.

Вторник, 14 февраля

Кампус Менло

9:00 — 15:00

9:00-9:30: 1-минутные выступления по позиционным документам

9:30–11:00: продолжение подготовки документов с изложением позиции

10:15-11:00: Текущие события

11:00-12:00: Дебаты и разговорная практика с текущими событиями

13:00–14:00: Продолжайте составлять документы с изложением позиции.

14:00–15:00: Приглашенный докладчик по международным делам

Закончите позиционную бумагу № 1.

Среда, 15 февраля

Кампус Менло

9:00 — 15:00

9:00–9:30: Парная критика позиционных документов.

9:30-11:00: пересмотр документов с изложением позиции; подготовить речь

11:00–12:00: Вступительные речи и критические замечания.

13:00–15:00: Проект документа с изложением позиции № 2.

Закончите позиционную бумагу № 2.

Польское вступительное слово.

Отправьте позиционные документы.

Четверг, 16 февраля

Путешествие в Вашингтон, округ Колумбия

Авиаперелет в Вашингтон, округ Колумбия

Смотрите подробную информацию о конференции NAIMUN здесь!

21:15–23:30: Заседание Комитета I.

Пятница, 17 февраля

Вашингтон Д.С.

8:00–12:00 Ознакомительные мероприятия в рамках конференции

(Посольский тур, тур по Капитолию или тур по памятникам)

13:00–21:00 Заседания Комитета II и III

Суббота, 18 февраля

Вашингтон Д.С.

9:00–20:00: Заседания Комитета IV и V.

21:30–00:00: Танец делегатов

Воскресенье, 19 февраля

Вернуться к С.Ф.

9:00-00:30: Заседание Комитета IV

Авиаперелет в Сан-Франциско

Предпосылки: Зимним спортсменам потребуется разрешение спортивного директора Криса Уимса. Нет других предпосылок.

Занятость с 9:00 до 15:00: Даты поездки: четверг, 16 февраля — воскресенье, 19 февраля.

Пожалуйста, запланируйте посещение обязательного собрания для родителей и учащихся, участвующих в выездных курсах, которое состоится в четверг, 19 января, в 19:00 в общежитии средней школы.

Плата за курс : 1600 долларов США (включая регистрацию на конференцию, авиабилеты и все обеды и ужины)

Конечный продукт: Уверенное участие в Model U.Конференция N с двумя заполненными документами с изложением позиции.

Регистрация на ночные курсы Включает следующие шаги и соблюдение следующих сроков:

17 октября: Если учащийся был переведен на ночной курс, учащийся и его семья будут проинформированы о предварительном размещении.

20 октября, 15:00: Чтобы обеспечить размещение, каждый из следующих предметов должен быть представлен Кэти Реттберг в библиотеке.Поздняя или неполная подача приводит к потере приоритета размещения.

1. Невозмещаемый депозит в размере 600 долларов США, подлежащий уплате Menlo School (укажите имя учащегося и пункт назначения в строке для заметок)

2. Подписанное родителем и заполненное Разрешение и отказ от прав родителей.

3. Заполненная форма авиаперелета.

4. Заполненный контракт на поездку.

13 декабря, 15:00: Окончательный платеж в размере 1000 долларов, подлежащий оплате школе Менло (укажите имя учащегося и пункт назначения в строке заметок) за Кэти Реттберг в библиотеке.

19 января 2017 г., 19:00, Общежитие средней школы:  Ночной информационный курс
Посещение обязательно для всех учащихся, зачисленных на ночные курсы, и по крайней мере для одного родителя/опекуна.

Последнее изменение: 6 октября 2016 г., 14:38, автор: .

Pie1, белок, взаимодействующий с Mec1, контролирует рост клеток и ответы контрольных точек у Saccharomyces cerevisiae

Mol Cell Biol.2001 г., февраль; 21(3): 755–764.

Tatsushi Wakayama

Отделение биологических наук, Высшая школа наук, Университет Нагоя, 1 и CREST, Японская научно-техническая корпорация, 2 Chikusa-ku, Nagoya 464-0814, Япония

Tae Kondo

Tae Kondo

Отделение биологических наук, Высшая школа наук, Университет Нагоя, 1 и CREST, Японская научно-техническая корпорация, 2 Тикуса-ку, Нагоя 464-0814, Япония

Сейко Андо

Отделение биологических наук, аспирант School of Science, Nagoya University, 1 и CREST, Japan Science and Technology Corporation, 2 Chikusa-ku, Nagoya 464-0814, Japan

Kunihiro Matsumoto

Отдел биологических наук, Высшая школа наук, Nagoya University , 1 и CREST, Japan Science and Technology Corporation, 2 Chikusa-ku, Nagoya 464-0814, Japan

Katsunori Sugimoto

900 02 Отделение биологических наук, Высшая школа наук, Университет Нагоя, 1 и CREST, Японская научно-техническая корпорация, 2 Чикуса-ку, Нагоя 464-0814, Япония

Отделение биологических наук, Высшая школа наук , Nagoya University, 1 и CREST, Japan Science and Technology Corporation, 2 Chikusa-ku, Nagoya 464-0814, Japan

* Автор, ответственный за переписку.Почтовый адрес: Отдел биологических наук, Высшая школа наук, Нагойский университет, Чикуса-ку, Нагоя 464-0814, Япония. Телефон: 81-52-789-2593. Факс: 81-52-789-2589. Электронная почта: [email protected]

Текущий адрес: Kyowa Hakko Kogyo Co. Ltd., Матида-ши, Токио 194-8533, Япония.

Поступила в редакцию 2000 г. 14 августа; Запрошены исправления 29 сентября 2000 г .; Принято 7 ноября 2000 г.

Copyright © 2001, Американское общество микробиологии Эта статья цитировалась в других статьях PMC.

Abstract

У эукариот белки семейств ATM и ATR играют критическую роль в контроле повреждений ДНК и контрольных точек репликации. Эти белки характеризуются киназным доменом, связанным с фосфатидилинозитол-3-киназой, но обладают способностью фосфорилировать белки. У почкующихся дрожжей белок семейства ATR Mec1/Esr1 необходим для ответов контрольных точек и роста клеток. Мы выделили ген PIE1 в ходе двухгибридного скрининга белков, которые взаимодействуют с Mec1, и мы показали, что Pie1 физически взаимодействует с Mec1 in vivo.Как и MEC1 , PIE1 необходим для роста клеток, а делеция гена PIE1 вызывает дефекты в контрольных точках повреждения ДНК и блока репликации, сходные с наблюдаемыми у мутантов mec1Δ . Гиперфосфорилирование Rad53 после повреждения ДНК и блокировки репликации также снижается в клетках pie1Δ , как и в клетках mec1Δ . Pie1 имеет ограниченную гомологию с Rad26 делящихся дрожжей, который образует комплекс с белком Rad3 семейства ATR.Мутация области в Pie1, гомологичной Rad26, приводит к фенотипу, подобному мутации pie1Δ . Активность протеинкиназы Mec1, по-видимому, важна для ответов контрольных точек и роста клеток. Однако на активность киназы Mec1 не влияет мутация pie1Δ , что позволяет предположить, что Pie1 регулирует некоторые важные функции, отличные от активности киназы Mec1. Т.о., Pie1 структурно и функционально родственен Rad26 и взаимодействует с Mec1, чтобы контролировать контрольные точки и пролиферацию клеток.

Когда репликация ДНК блокируется и происходит повреждение ДНК, контрольные точки останавливают клеточный цикл, позволяя репликации и репарации ДНК происходить (13, 19). Потеря контрольной точки приводит к гибели клеток или генетической нестабильности, что может привести к раку. Пути контрольных точек являются эволюционно консервативной особенностью эукариотических клеток. Примером такой консервативности является семейство генов, кодирующих высокомолекулярные протеинкиназы, включая ATM (млекопитающие), ATR (млекопитающие), MEC1 ( Saccharomyces cerevisiae ), TEL1 ( S.Cerevisiae ), RAD3 + + ( Schizosaccharomymes Pombe ), Mei-41 ( Mei-41 ( Drosophila Melanogaster ) и UVSB ( Aspergillus nidulans ) (6, 9, 18, 22, 23, 23, 30, 37, 40, 48). Каждый из этих генов попадает в две семейные группы на основе гомологии; ATM наиболее тесно связан с TEL1 , а ATR больше связан с MEC1 , rad3 + , mei-41 , и Эта гомология не ограничивается киназным доменом на карбоксильном конце, а распространяется по всей длине белка. Карбоксильно-концевой киназный домен структурно связан с каталитическим доменом фосфатидилинозитол (PI) 3-киназ. Несмотря на это сходство, ни один из этих белков не фосфорилирует липиды. ATM, ATR и Rad3 способны фосфорилировать белковые субстраты (5, 8, 28, 29). Однако еще предстоит определить, как киназная активность этих белков контролируется в ответах контрольных точек.Более того, мало известно о том, образуют ли эти белки комплексы с другими белками, хотя недавно было показано, что Rad3 образует комплекс с Rad26 (12). Единственным гомологом Rad26, идентифицированным до сих пор, является A. nidulans UVSD (40), но не было определено, взаимодействует ли UVSD с ATR-родственным UVSB.

У почкующихся дрожжей Mec1 играет важную роль в контроле контрольных точек. У почкующихся дрожжей были охарактеризованы три зависимых от клеточного цикла ответа на повреждение ДНК, известные как G 1-, S- и G 2 /M-фазы повреждения.Mec1 необходим для всех трех контрольных точек повреждения ДНК (25), а также контрольной точки блока репликации ДНК (48). Предполагается, что Tel1 играет дублирующую роль с Mec1 в ответах контрольных точек (30). Помимо MEC1 и TEL1 , был идентифицирован ряд генов, которые участвуют в контрольной точке повреждения ДНК и/или контрольной точке блока репликации ДНК. К ним относятся CHK1 , DDC1 , Mec3 , RAD9 , RAD17 , RAD24 и RAD53 / MEC2 (2, 25-27, 35, 38, 46-48). RAD53 и CHK1 , кодирующие протеинкиназы, функционируют ниже MEC1 в путях контрольных точек. Rad53, как и Mec1, играет роль как в блоке репликации, так и во всех трех контрольных точках повреждения ДНК (2, 48). После повреждения ДНК и блокады репликации Rad53 гиперфосфорилируется и активируется механизмом, зависящим от Mec1 (36, 42). Т.о., Mec1 и Rad53 составляют центральный путь контрольных точек у почкующихся дрожжей. Chk1 играет роль в контрольной точке повреждения ДНК G 2 /M-фазы и гиперфосфорилируется после повреждения ДНК Mec1-зависимым образом (35). RAD9 , RAD17 , MEC3 , DDC1 и RAD24 необходимы для всех трех контрольных точек повреждения ДНК (25). Rad9 гиперфосфорилируется после повреждения ДНК, а фосфорилированный белок Rad9 связывается с Rad53, возможно, модулируя активность Rad53 (14, 43, 45). Генетические данные свидетельствуют о том, что RAD17 , RAD24 , MEC3 и DDC1 действуют по одному и тому же пути контрольных точек (25). Ddc1, Mec3 и Rad17 физически взаимодействуют друг с другом, но не с Rad24 (24).Вместо этого Rad24 образует комплекс с Rfc2, Rfc3, Rfc4 и Rfc5 (16, 31, 38) и предполагается, что он действует выше комплекса Rad17-Mec3-Ddc1 (24). Ddc1 также гиперфосфорилируется Mec1-зависимым образом после повреждения ДНК (33). Т.о., Mec1 может регулировать путь контрольных точек Rad17-Rad24 путем фосфорилирования Ddc1. В дополнение к своей роли в контрольных точках, MEC1 необходим для роста клеток, а мутация mec1Δ является летальной. Эта летальность подавляется мутациями sml1 или сверхэкспрессией RNR1.RNR1 кодирует большую субъединицу рибонуклеотидредуктазы, тогда как SML1 кодирует небольшой белок, который связывается с Rnr1 (10, 50). Делеция SML1 вызывает увеличение пула дезоксинуклеозидтрифосфатов; таким образом, Mec1 может способствовать репликации ДНК путем ингибирования Sml1 и, таким образом, увеличения пула доступного дезоксинуклеозидтрифосфата (50). Хотя роли Mec1 в контроле контрольных точек и пролиферации клеток были охарактеризованы, не было идентифицировано белка, который взаимодействует с Mec1 и/или регулирует его.

В этой статье мы описываем выделение PIE1 в двухгибридном скрининге дрожжей в поисках белков, которые взаимодействуют с Mec1. Мы показываем, что Pie1 физически взаимодействует с Mec1 in vivo. Мутация pie1Δ придает тот же фенотип, что и мутация mec1Δ , в отношении роста клеток и ответов контрольных точек. Т.о., Pie1 играет критическую роль в контроле контрольных точек и пролиферации клеток, взаимодействуя с Mec1.

МАТЕРИАЛЫ И МЕТОДЫ

Штаммы, среды и общие методы.

Штаммы дрожжей, использованные в этом исследовании, являются изогенными и перечислены в Таблице . Стандартные генетические методы использовались для манипулирования штаммами дрожжей (17, 21). Полную синтетическую (SC) среду, содержащую 0,5% казаминовых кислот и соответствующие добавки, использовали для поддержания отбора плазмид URA3 и TRP1 .

ТАБЛИЦА 1

Штаммы, используемые в данном исследовании с

KSC1196 MAT A Pie1-Myc∷trp1 ADE1 HIS2 TRP1 URA3 Leu2 8 KSC1214
Штамм генотипа
KSC006 МАТ ade1 his2 trp1 URA3 leu2
KSC783 Mat A Mec1-1 SML1-1 TRP1 URA3 LEU2
MAT A SML1Δ∷leu2 ADE1 HIS2 TRP1 URA3 LEU2
KSC1180
МАТ pie1Δ∷TRP1 sml1Δ∷LEU2 ade1 his2 trp1 URA3 leu2
KSC1186 МАТ mec1Δ∷LEU2 sml1Δ∷LEU2 ade1 his2 trp1 URA3 leu2
MAT a mec1Δ∷LEU2 pie1Δ∷TRP1 sml1Δ∷LEU2 ade1 his2 trp1 ura3 leu2
9 KSC121 2 MAT A A MEC1-Ha∷ura3 ADE1 HAS2 TRP1 URA3 LEU2
MAT A MEC1-HA∷URA3 Pie1-Myc∷trp1 ADE1 HET2 TRP1 URA3 LEU2
KSC1215 KSC1215 MAT A MEC1-HA∷URA3 SML1Δ∷leu2 Ade1 Hy2 TRP1 URA3 Leu2
KSC1234 MAT Pie1Δ∷leu2 SML1δ∷leu2 ADE1 HIS2 TRP1 URA3 LEU2
KSC1286 KSC286 MAT A Mec1-Ha∷ura3 Pie1Δ∷leu2 sml1Δ∷LEU2 ade1 his2 trp1 ura3 leu2
Плазмиды и нарушения генов.

Для конструирования амино-концевой меченной HA версии MEC1 5′-некодирующие и амино-концевые области гена MEC1 амплифицировали с помощью ПЦР с 5′-некодирующими праймерами HA-MEC1 KS113 (5′ -TACGCGTAATCTGGAACATCGTATGGATATGATTCCATGCAGTCTTGT-3 ‘) и KS006 (5′-AATTAACCCTCACTAAAGGGAAC-3’) или амино-концевой HA-MEC1 праймеры KS114 (5′-TACGCGTATCCTTATGACGTACCAGATTATGCGGAATCACACGTCAAATATC-3 ‘) и KS007 (5′-TTTTACGACTCACTATAGGGCGA-3’). Плазмида YEp-MEC1-HA была сконструирована путем лигирования из трех частей Eco RI- Mlu I, обработанного ПЦР-амплифицированным 5′-некодирующим фрагментом, и Hin dIII- Mlu I, обработанного, ПЦР-амплифицированный амино-концевой фрагмент с Eco RI- Hin dIII-линеаризованным YEp-MEC1 (41).Для конструирования киназоотрицательной версии MEC1 ( mec1-KN ) был проведен мутагенез in vitro с заменой аспарагиновой кислоты на серин в положении 2224 и аспарагина на серин в положении 2229 с помощью ПЦР с использованием YEp-MEC1 с олигонуклеотидные праймеры KS006, KS106 (5′-CACGTTTTGGCTAGATATTGCGGCC-3′), KS118 (5′-ATATTAGGTCTAGGATCCAGGCACTGTGAAAGCATATTACTA-3′) и KS119 (5′-ATCTAGTAATATGCTTTCACAGTGCCTGGATCCTAGACCTAATAT-3′). Фрагмент Kpn I- Bst EII YEp-MEC1-HA был заменен на 0.Фрагмент 4 т.п.н. Kpn I- Bst EII из продукта ПЦР, генерирующий YEp-MEC1-KN-HA. Для создания pBD-MEC1(2-2368) фрагмент Mlu I- Sal I YEp-MEC1-KN-HA был клонирован в сайты Mlu I- Sal I плазмиды pGBDm. pGBDm представляет собой модифицированную версию pGBDU-C1 (20), в которой сайт множественного клонирования содержит сайт рестрикции Mlu I (получен от T. Naiki). Для конструирования плазмид pBD-MEC1(2–938) и pBD-MEC1(2–1399) pBD-MEC1(2–2368) обрабатывали Afl II- Sal I или Nhe I- Sal. I, соответственно, тупой и самолигирующийся.Фрагмент, содержащий центральную область MEC1 , был получен методом ПЦР с использованием праймеров KS491 (5′-TGCGGATCCGAGAAAACTGGCAACCCTTTC-3′) и KS492 (5′-GATGTCGACTTAAGTCCTTAATGGATCCTCGTTTG-3′). ПЦР-фрагмент расщепляли Bam HI и Sal I, а затем клонировали в сайты Bam HI- Sal I pGBDU-C1, создавая pBD-MEC1(496–1590). Аминоконцевой фрагмент Mec1 (со 2-го по 500-е положения) клонировали в сайты Mlu I- Sal I плазмиды pGBDm после амплификации соответствующего фрагмента методом ПЦР с праймерами KS488 (5′-TCGGTCGACTTAGTTGCCAGTTTTCTCAATATCGC-3′) и KS489 (5′-AAAACGCGTATCCTATGACGTAC-3′).Для конструирования pBD-MEC1(1586–2368) фрагмент Bam HI- Sal I из pBD-MEC1(2–2368) был клонирован в сайты Bam HI- Sal I pGDBU-C3 ( 20). Для конструирования YIp-MEC1-HA фрагмент Spe I- Xho I из YEp-MEC1-HA и фрагмент Kpn I- Spe I 5′-некодирующей последовательности MEC1 клонировали в сайты Kpn I- Xho I pRS306. Ген PIE1 клонировали методом ПЦР с праймерами KS418 (5′-CGAXGAATTCCAACACGAAATCCAGTTCTTCGACC-3′) и KS419 (5′-TGTGGTCGACGTTCTTTCCATGTTCAAAAAGAAGAC-3′).После обработки Eco RI- Sal I фрагмент был субклонирован в YCplac22 и YCplac33 (15), создавая YCpT-PIE1 и YCp-PIE1 соответственно. Для создания pAD-PIE1 открытую рамку считывания PIE1 клонировали в сайты Bam HI- Sal I pGAD-C1 (20) с помощью ПЦР с использованием праймеров KS436 (5′-CTCGGATCCATGAGACGAGAAACGGTGGGT-3′) и KS437. (5′-CTCGTCGACCTTACAGTCCCATTGAGAT-3′). Последовательность эпитопа myc сливали с последовательностью, кодирующей аминоконцевой Pie1, с помощью ПЦР с использованием праймеров KS427 (5′-CTCACGCGTGTTCAAATCTTCCTCAGATATCAGTTTCTGTTCTCGTCTCATCTA TAATAGAAATAT-3′) и KS428 (5′-CTCACGCGTGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAACGGTGGGTGAATTTTCT-3′).После обработки Mlu I и самолигирования был получен YCpT-PIE1-myc. Для создания YIp-PIE1-myc YCpT-PIE1-myc расщепляли Bgl II и самолигировали. Штаммы MEC1-HA и PIE1 myc были получены после трансформации YIp-MEC1-HA и YIp-PIE1-myc после обработки Psh AI и Pst I соответственно. Для создания YCpT-PIE1-ΔC-myc мутагенез in vitro для создания кодона терминации был выполнен с помощью ПЦР с праймерами KS461 (5′-CCAGAATATATCGAAGAATTGAAGATGCAATAACCGCGGAAA-3′) и KS462 (5′-CTTGCATTATTCTCCCCGTTTCTTTTATTCCGCGGAAA-3′) и Ned . Фрагмент I- Sal I YCpT-PIE1-myc был заменен соответствующим продуктом ПЦР.Для создания YCpT-PIE1-KA-myc открытую рамку считывания амплифицировали с помощью ПЦР с праймерами KS481 (5′-AATCCGCGGCACGTAAGATAAGTGATAATTTACTGAAAAAAAATATGGT-3′) и KS482 (5′-GTGCCGCGGATTGTGGTGATTGAGGTTTTGC-3′) и Mlu I- Xba. Фрагмент I YCpT-PIE1-myc был заменен соответствующим ПЦР-фрагментом. Замещенные ПЦР-фрагменты были полностью секвенированы. Фрагмент Sal I из YEp-Rad53 (41), содержащий последовательность, кодирующую карбоксиконцевую половину Rad53, был клонирован в pGEX-5X-2, обработанную Sal I (Amersham Pharmacia Biotech), с созданием pGST-Rad53. .YCp-RAD53-HA был описан ранее (41). Гены PIE1 и SML1 были делетированы с помощью делеции на основе ПЦР с использованием генов Candida glabrata TRP1 и LEU2 (полученных от K. Kitada). Нарушение MEC1/ESR1 было описано ранее (22). Нарушение каждого гена подтверждали с помощью ПЦР. Затем гетерозиготные диплоиды спорулировали, а тетрады препарировали. Меченые конструкции ( MEC1-HA и PIE1-myc ) экспрессировали белки подходящего размера из их собственного промотора и дополняли их соответствующие нулевые мутации в отношении роста клеток и чувствительности к агентам, повреждающим ДНК.

Двухгибридное просеивание.

Двухгибридный скрининг экспрессионной библиотеки S. cerevisiae (подарок P. James) проводили, как описано ранее (24), с использованием pBD-MEC1(2–1399) в качестве приманки. После трансформации библиотекой приблизительно 100 колоний клеток PJ69-4A, несущих pBD-MEC1(2–1399), выросли на селективной среде, содержащей 10 мМ 3-аминотриазола (АТ). Тест на эффективность трансформации показал, что в этом скрининге было получено 4 × 10 6 Ura + Leu + трансформантов.В общей сложности 48 плазмид повторно протестированы как положительные, и 17 из них были выбраны для дальнейшего анализа. Рестрикционный анализ и анализ последовательности с последующим поиском в базе данных ДНК показали, что 12 из этих плазмид содержали YDR499/PIE1 .

УФ-излучение и лекарственная чувствительность.

Дрожжевые клетки предварительно культивировали в среде дрожжевой экстракт-пептон-декстроза (YEPD) или SC, подходящей для отбора плазмид TRP1 и/или URA3 . Затем клетки разбавляли в YEPD и позволяли им расти при 30°C в течение 3 ч, после чего подвергали УФ-облучению и лекарственной обработке.Анализ чувствительности к УФ-излучению проводили, как описано ранее (41). Чувствительность к метилметансульфонату (MMS) определяли, как описано ранее (41). Клетки инкубировали с ММС при 30°С в течение 30 мин. Инкубацию останавливали добавлением тиосульфата натрия до конечной концентрации 5%. Анализ чувствительности к гидроксимочевине (HU) проводили, как описано ранее (38).

Эксперименты по синхронизации УФ и ММС.

Для анализа задержки клеточного цикла при переходе G 2 /M логарифмические культуры при 30°C предварительно останавливали 6 мг α-фактора на мл в течение 120 мин, промывали водой и затем выдерживали в течение 120 мин. в YEPD, содержащий 15 мг нокодазола в минуту, для синхронизации клеток в G 2 /M.Клетки, арестованные в G 2 /M, распределяли на пластинах YEPD и облучали УФ-лампой с длиной волны 254 нм при 75 Дж/м 2 . Затем клетки промывали для удаления нокодазола и помещали в свежий YEPD, содержащий 1% диметилсульфоксида, при 30°С. Через определенные промежутки времени клетки извлекали и окрашивали 4′,6-диамидино-2-фенилиндолом (DAPI) для микроскопического исследования. Эксперимент синхронии MMS для мониторинга регуляции S-фазы и эксперимент синхронизации UV для анализа задержки клеточного цикла при переходе G 1 /S проводили, как описано ранее (31).

Иммунофлуоресцентный микроскопический анализ.

Клетки дрожжей выращивали в среде YEPD при 30°C. Для изучения удлинения веретена при 30°C культуру синхронизировали в фазе G 1 добавлением 6 мг α-фактора на мл при 30°C в течение 2 ч. Затем клетки промывали для удаления α-фактора и высвобождали в YEPD, содержащем 100 мМ HU, при 30°C. Аликвоты клеток удаляли и обрабатывали для анализа проточной цитометрии ДНК, оценки жизнеспособности и непрямой иммунофлуоресцентной микроскопии, как описано ранее (41).

Иммуноблоттинг.

Белковые экстракты для иммуноблоттинга готовили и разделяли электрофорезом в полиакриламидном геле с додецилсульфатом натрия (SDS-PAGE), как описано ранее (41). Затем белки переносили на нейлоновые мембраны, подвергали иммуноблот-анализу с моноклональными антителами против HA (3F10, 12CA5 или 16B12), против myc (9E10) или против белка комплекса ядерной поры (MAb414) (4) или поликлональные антитела против Ssb1 (полученные от S. Nishikawa) и обнаруженные с использованием набора ECL (Amersham Pharmacia Biotech).

Ядерное и цитоплазматическое фракционирование.

Ядро и цитоплазму разделяли по существу, как описано ранее (3). Клетки дрожжей предварительно культивировали в среде SC, подходящей для отбора плазмид TRP1 . Их разводили в YEPD и оставляли расти при 30°C в течение 3 часов. Клетки с оптической плотностью при 600 нм 100 собирали центрифугированием и инкубировали в 50 мМ Tris-H 2 SO 4 (pH 9,0)–10 мМ дитиотреитола при 30°C в течение 5 мин. Затем их превращали в сферопласты в 5 мл сорбитового буфера (1.2 М сорбита, 40 мМ трис-HCl [pH 8,0], 10 мМ дитиотреитола), содержащих 500 мкг зимолиазы 100Т, после инкубации при 30°С. Сферопласты наносили на 7,5% буфер фиколла-сорбита (7,5% фиколла в 1,2 М сорбите, 40 мМ трис-HCl [pH 8,0] и 0,5 мМ фенилметилсульфонилфторида [PMSF]) и собирали центрифугированием при 4000 × g в течение 5 мин при 4°С. Сферопласты ресуспендировали в 7 мл 20% фиколла в фосфатном буфере (20 мМ фосфата калия [рН 6,5], 1 мМ MgCl 2 , по 1 мг лейпептина и пепстатина на мл, 0.5% апротинина, 1 мМ PMSF, 10 мМ бензамидин-HCl), осторожно гомогенизировали (25 ударов в гомогенизаторе Даунса) и центрифугировали при 8000 × g в течение 5 мин. После центрифугирования при 8000× g в течение 10 мин супернатант загружали на 30% фиколл в фосфатном буфере и центрифугировали при 24000 об/мин в течение 60 мин в роторе Beckman SW60Ti. Слой 20% фиколла извлекали в виде цитоплазматической фракции, а осадки суспендировали в лизирующем буфере в виде ядерной фракции.

Иммунопреципитация и киназный анализ.

Дрожжевые клетки предварительно культивировали в среде YEPD или SC, подходящей для отбора плазмид TRP1 и/или URA3 . Затем клетки разводили в YEPD и оставляли расти при 30°C в течение 3 часов. При обработке ММС культуру инкубировали в 0,1% ММС в течение 1 часа. Клетки (оптическая плотность при 600 нм = 40) осаждали, промывали и ресуспендировали в 150 мл буфера для лизиса (20 мМ Трис-HCl [pH 8,0], 100 мМ NaCl, 1 мМ ЭДТА, 1 мМ ортованадата натрия, 1 мМ дитиотреитол, 0,1% Тритон Х-100, 40 мМ β-глицерофосфат, 15 мМ p -NO 2 -фенилфосфат, 1 мг лейпептина на мл, 1 мг пепстатина на мл, 0.5% апротинина, 100 мг АФМСФ на мл). Добавляли равный объем стеклянных шариков и клетки лизировали встряхиванием. Экстракты осветляли центрифугированием в течение 15 мин при 4°С. Супернатант разбавляли лизисным буфером и инкубировали при 4°С в течение 2 ч с гранулами протеина А-Сефарозы, связанными с анти-HA или анти-myc антителами. Концентрацию белка определяли с помощью белкового анализа (Bio-Rad). Иммунопреципитаты промывали четыре раза лизирующим буфером и дважды киназным буфером (20 мМ натрия HEPES [pH 7.5], 10 мМ MgCl 2 , 4 мМ MnCl 2 ). Для экспериментов по коиммунопреципитации иммунопреципитаты немедленно кипятили в буфере для образцов 1 × SDS-PAGE. Для анализа киназы иммунопреципитаты разделяли на равные части для иммуноблоттинга и киназной реакции. Киназную реакцию инициировали в 50 мкл киназного буфера добавлением 10 мКи [γ- 32 P]АТФ (3000 Ки/ммоль) (Amersham Pharmacia Biotech), 1 мкг глутатион S -трансферазы (GST )–Rad53 и АТФ до 50 мкМ.Реакции останавливали добавлением 5-кратного буфера для образцов и кипячением в течение 5 мин. Элюированные белки разделяли с помощью SDS-PAGE, гели сушили и подвергали авторадиографии.

РЕЗУЛЬТАТ

Pie1 физически взаимодействует с Mec1.

В попытке идентифицировать белки, взаимодействующие с Mec1, мы провели двухгибридный скрининг экспрессионной библиотеки почкующихся дрожжей. В качестве приманки мы использовали производное Mec1, лишенное киназного домена (аминокислоты со 2 по 1399 Mec1). Мы выделили 17 положительных клонов и обнаружили, что 12 из них содержали YDR499 , слитых с доменом активации транскрипции.Поэтому мы выбрали YDR499 для дальнейшего анализа. Далее YDR499 обозначается как PIE1 , кодирующий белок, взаимодействующий с Mec1/Esr1. Было также обнаружено, что полноразмерный белок Mec1 взаимодействует с Pie1 в двухгибридном анализе (рис. A). Предсказанный продукт гена PIE1 из 747 аминокислот имеет расчетную молекулярную массу 86 кДа. Поиск в базе данных показал, что Pie1 имеет область, слабо гомологичную S. pombe Rad26 (1) и A.белки nidulans UVSD (40) (рис. ). Было показано, что белок Rad26 физически взаимодействует с белком Rad3 семейства ATR (12).

Взаимодействие между Mec1 и Pie1 в двухгибридном анализе. (A) Pie1 взаимодействует с Mec1 в двухгибридном анализе. Штамм PJ69-4A, несущий pBD-MEC1(2–2368), трансформировали pAD-PIE1 или контрольным вектором. Трансформанты высевали штрихами на чашку SC-Ura-Leu-His, содержащую 10 мМ АТ. (B) Идентификация региона Mec1, необходимого для его взаимодействия с Pie1.Штамм PJ69-4A, несущий pAD-PIE1, трансформировали pBD-MEC1(2–2368), pBD-MEC1(2–1399), pBD-MEC1 (2–938), pBD-MEC1(2–500), pBD-MEC1. (496–1590) или pBD-MEC1 (1586–2368). Домен киназы и центральная гомологичная область Mec1 обозначены черными и серыми полосами соответственно. Трансформанты высевали штрихами на чашку SC-Ura-Leu-His, содержащую 10 мМ АТ. Взаимодействие с Pie1 оценивали путем измерения роста трансформантов.

Структура и выравнивание Pie1, S. pombe Rad26 и A.нидуланс УВСД. Белки Pie1, S. pombe Rad26 и A. nidulans UVSD содержат 747, 614 и 778 аминокислот соответственно. Выравнивание консервативных областей этих трех белков показано ниже. Идентичные или консервативные аминокислоты обозначены черным и серым прямоугольниками соответственно.

Чтобы проверить, взаимодействует ли Pie1 физически с Mec1 in vivo, мы провели эксперименты по иммунопреципитации. Для этой цели мы создали конструкции MEC1 с меткой HA и PIE1 с меткой myc и заменили соответствующие геномные копии мечеными конструкциями.Экстракты готовили из клеток и подвергали иммунопреципитации антителами против НА. Затем иммунопреципитаты исследовали с помощью антител против эпитопов HA и myc. При зондировании антителами против HA полосы, соответствующие Mec1, были обнаружены в клетках MEC1-HA . При иммуноблотинге с анти-myc антителами полосы, соответствующие Pie1-myc, были обнаружены только в клетках, экспрессирующих как Mec1-HA, так и Pie1-myc (рис. 1). В обратном эксперименте экстракты подвергали иммунопреципитации анти-myc антителами.Затем иммунопреципитаты анализировали с помощью иммуноблоттинга с антителами против эпитопов HA и myc. При зондировании антителами против HA Pie1-myc обнаруживался только в иммунопреципитатах против HA из экстрактов клеток, экспрессирующих как Mec1-HA, так и Pie1-myc (рис. 1). Эти наблюдения демонстрируют, что Pie1 и Mec1 физически взаимодействуют in vivo.

Взаимодействие между Mec1 и Pie1 in vivo. Экстракты готовили из клеток MEC1-HA (KSC1212), PIE1-myc (KSC1213) и MEC1-HA PIE-myc (KSC1214) и подвергали иммунопреципитации (IP) с анти-HA (левая панель). ) или антитела против myc (правая панель).Иммунопреципитаты разделяли с помощью SDS-PAGE и подвергали иммуноблот-анализу с антителами против HA или против myc.

Белок Mec1 разделен на три области, как и другие белки семейства ATR (6). Карбоксил-концевые киназные домены высококонсервативны среди белков семейства ATR, а центральные области также демонстрируют значительную гомологию. Напротив, среди аминоконцевых областей не наблюдается очевидной гомологии. Чтобы очертить область Mec1, которая взаимодействует с Pie1, мы сконструировали приманки, содержащие различные фрагменты MEC1 , и проверили их способность взаимодействовать с Pie1 в двухгибридной системе дрожжей (рис.Б). Мы обнаружили, что Pie1 взаимодействует с амино-концевой областью Mec1, соответствующей аминокислотам со 2 по 500, областью, которая не является консервативной среди членов семейства ATR.

PIE1 необходим для роста клеток.

Чтобы изучить функцию PIE1 , мы создали нулевой штамм путем разрушения гена (см. Материалы и метод). Гетерозиготный диплоид PIE1/pie1 Δ∷TRP1 спорулировался, и в каждой тетраде были жизнеспособны только две споры. Все жизнеспособные споры представляли собой Trp , содержащие ген PIE1 дикого типа.Эти результаты показывают, что PIE1 необходим для роста клеток. MEC1 требуется для роста клеток в дополнение к контрольным точкам, а летальность мутации mec1Δ подавляется мутациями sml1Δ (50). Чтобы проверить, сохраняется ли летальность pie1Δ также с помощью мутации sml1Δ , были спорулированы диплоиды pie1Δ/PIE1 sml1Δ/SML1 . Были извлечены клетки Trp + , и все они оказались Leu + , что указывает на жизнеспособность клеток pie1Δ sml1Δ (рис.). Клетки с двойным мутантом pie1Δ sml1Δ росли так же, как клетки дикого типа и мутантные клетки sml1Δ . Более того, мутация sml1Δ аналогичным образом подавляла летальность двойной мутации mec1Δ pie1Δ (см. ниже). Т.о., потеря жизнеспособности, вызванная разрушением pie1 , компенсируется мутацией sml1Δ , что свидетельствует о том, что Pie1 и Mec1 выполняют одинаковую функцию в росте клеток.

pie1 Δ летальность подавляется мутацией sml1 Δ.Диплоид pie1Δ∷TRP1/+ sml1Δ∷LEU2 /+ спорулировали и препарировали на чашке YEPD. Семь тетрад отображаются вертикально. Спорулированные тетрады, выращенные на чашке YEPD, повторно высевали на чашку SC-Trp или SC-Leu. Все клетки, пролиферирующие на SC-Trp, представляют собой Leu + , что указывает на жизнеспособность двойных мутантов pie1Δ∷TRP1 sml1Δ∷LEU2 .

Влияние мутации
pie1Δ на повреждение ДНК и контрольные точки блока репликации.

Подавление летальности pie1Δ мутацией sml1Δ позволило нам изучить фенотип, связанный с полной потерей функции PIE1 .Мы проверили чувствительность мутантов pie1Δ к HU, MMS и УФ-свету и обнаружили, что штаммы pie1Δ sml1Δ значительно более чувствительны, чем штаммы sml1Δ (рис. ). Затем мы сравнили чувствительность штаммов pie1Δ , mec1Δ и двойных мутантов mec1Δ pie1Δ на фоне sml1Δ . На фоне sml1Δ штамм pie1Δ показал такую ​​же чувствительность к HU, MMS и УФ-облучению, что и штаммы mec1Δ и mec1Δ pie1Δ (рис.), предполагая, что Pie1 и Mec1 функционируют одним и тем же путем после повреждения ДНК и блокады репликации.

Чувствительность мутантов pie1Δ, mec1Δ и mec1Δ pie1Δ к HU, MMS и УФ. sml1Δ (KSC1178), pie1Δ sml1Δ (KSC1180), mec1Δ sml1Δ (KSC1186) и mec1Δ pie1Δ sml1Δ (KSC1196) Жизнеспособность клеток оценивали, как описано в разделе «Материалы и методы».

Затем мы проверили, являются ли мутанты pie1Δ дефектными в отношении повреждений ДНК и контрольных точек блока репликации. Сначала мы исследовали контрольную точку повреждения ДНК G 2 /M-фазы, отслеживая митотическое деление после УФ-облучения (рис. 1). Когда клеточные культуры были высвобождены из-под ареста нокодазола после УФ-облучения, клетки дикого типа демонстрировали задержку ядерного деления, в то время как клетки pie1Δ продолжали митоз с той же скоростью, что и клетки mec1Δ .Точно так же штаммы pie1Δ прогрессировали так же быстро, как и штаммы mec1Δ , через переход G 1 /S и фазу S после повреждения ДНК (данные не показаны). Далее мы исследовали контрольную точку блока репликации ДНК у мутантов pie1Δ . Клетки синхронизировали с α-фактором и высвобождали в среду, содержащую HU. Через 120 минут после высвобождения в HU клетки дикого типа задерживались в виде крупных отпочковавшихся клеток с короткими веретенами, в то время как треть мутантов pie1Δ и mec1Δ демонстрировала удлиненные веретена (таблица).Эти результаты показывают, что мутанты pie1Δ столь же дефектны, как и мутанты mec1Δ , в G 1 -, S- и G 2 /M-фазе повреждения ДНК и контрольных точках блока репликации.

G 2 /M-фаза Контрольная точка повреждения ДНК у мутантов pie1Δ и mec1Δ . Клетки sml1Δ (KSC1178), pie1 sml1 (KSC1180) и mec1 sml1 (KSC1186) останавливали с помощью нокодазола и облучали или не облучали УФ.В указанные моменты времени после высвобождения из нокодазола культур, облученных УФ-излучением (+УФ) и необлученных (-УФ), процент одноядерных крупных клеток с почками подсчитывали с помощью окрашивания DAPI. Таблица 2


Короткий шпиндель Удлиненный шпиндель sml1 Δ 98 2 pie1Δ sml1 Δ 63 37 mec1Δ sml1 Δ 65 35

Rad53 фосфорилируется в ответ на повреждение ДНК и блокирование репликации Mec1-зависимым образом, и это фосфорилирование коррелирует с активацией путей контрольных точек (36, 42).Поэтому мы исследовали, требуется ли также PIE1 для фосфорилирования Rad53. Как наблюдалось у мутантов mec1Δ , фосфорилирование Rad53 после обработки HU и MMS было значительно снижено у мутантов pie1Δ (рис. 1). Эти результаты показывают, что PIE1 и MEC1 играют аналогичные роли в контрольных точках повреждения ДНК и блока репликации.

HU- и MMS-индуцированная модификация Rad53 у мутантов pie1Δ и mec1Δ .Клетки sml1Δ (KSC1178), pie1Δ sml1Δ (KSC1180) и mec1Δ sml1Δ (KSC1186), несущие YCp-RAD53-HA, оставляли необработанными или обрабатывали 10 мг/HU на мл в течение 120 мин или 0 в течение 30 мин, а затем подвергали иммуноблот-анализу, как описано в разделе «Материалы и методы».

Анализ консервативных и карбоксиконцевых областей Pie1.

Одна область внутри Pie1 гомологична Rad26 и UVSD (1, 40), и никакие другие области не проявляют значительной гомологии.Было показано, что мутация rad26.a14 , которая локализуется на карбоксильном конце, вызывает дефект в ответ на блок репликации, но не на повреждение ДНК (44) (Fig. A). Поэтому мы были заинтересованы в изучении роли карбоксиконцевого Pie1 в ответе на повреждение ДНК и блокировку репликации. Поскольку внутри Pie1 отсутствует значительная гомология последовательностей с Rad26 и UVSD, мы сконструировали укороченную мутацию pie1-ΔC , в которой удалены 47 аминокислот на карбоксильном конце (рис.А). Мы трансформировали плазмиду, несущую ген мутации pie1-ΔC , в клетки pie1Δ sml1Δ и исследовали их чувствительность к повреждению ДНК и обработке HU. Клетка, несущая мутацию pie1-ΔC , показала такую ​​же чувствительность, как и мутантные клетки, несущие контрольный вектор (рис. Б). Кроме того, мутационный ген pie1-ΔC не смог дополнить летальность pie1Δ (данные не показаны). Затем мы использовали коиммунопреципитацию, чтобы проверить, взаимодействует ли белок Pie1-ΔC с Mec1.Клетки pie1Δ sml1Δ , экспрессирующие клетки Mec1-HA, трансформировали центромерными плазмидами, несущими PIE1-myc или pie1-ΔC-myc . Экстракты готовили из трансформантов и подвергали иммунопреципитации антителами против НА. Затем иммунопреципитаты и экстракты зондировали антителами к эпитопам HA и myc. Хотя клетки экспрессировали мутантные белки Pie1-myc и Pie1-ΔC-myc на сходном уровне, Pie1-ΔC-myc не копреципитировался с Mec1-HA (рис.С). Эти результаты предполагают, что карбоксильный конец Pie1 необходим для взаимодействия с Mec1.

Анализ мутаций Pie1 в консервативном домене и карбоксильном конце. (A) Мутации Pie1 в консервативной и карбоксиконцевой областях. Показаны структуры и консервативные области Pie1 и S. pombe Rad26. Мутация pie1-KA заменяет лизин на аланин в положениях аминокислот 177 и 178 (обозначенных точками) в консервативной области. В продукте гена pie1-ΔC отсутствуют 47 аминокислот на карбоксильном конце.Звездочкой отмечено расположение мутации rad26.a14 . (B) Чувствительность мутантов pie1-KA и pie1-ΔC к HU, MMS и УФ. Клетки pie1Δ sml1Δ (KSC1234) трансформировали YCpT-PIE1-myc, YCpT-PIE1-KA-myc, YCpT-PIE1-ΔC-myc или контрольным вектором. Трансформанты выращивали до логарифмической фазы и обрабатывали HU, MMS или УФ-светом. Жизнеспособность клеток оценивали, как описано в разделе «Материалы и методы». (C) Взаимодействие мутантных белков Pie1-KA и Pie1-ΔC с Mec1.Экстракты готовили из клеток MEC1-HA pie1Δ sml1Δ (KSC1286), несущих YCpT-PIE-myc (WT), YCpT-PIE1-KA-myc (KA) или YCpT-PIE1-ΔC-myc (ΔC), и подвергали иммунопреципитация (ИП) с антителами против НА. Экстракты и иммунокомплексы разделяли с помощью SDS-PAGE и подвергали иммуноблотингу с антителами против HA или против myc.

Затем мы изучили значение области внутри Pie1, которая гомологична Rad26 и UVSD. Мы сконструировали мутацию ( pie1-KA ), в которой лизины в положениях 177 и 178 были заменены на аланины в пределах участка основных аминокислот, который является наиболее гомологичным участком в пределах Pie1 (рис.А). Мы трансформировали плазмиду pie1-KA в мутанты pie1Δ sml1Δ и обнаружили, что эти трансформанты были столь же чувствительны к HU, MMS и УФ-свету, как и клетки, несущие контрольный вектор (рис. B). Более того, ген pie1-KA не дополнял летальность pie1Δ (данные не показаны). Мы также исследовали взаимодействие мутантных белков Pie1-KA-myc с Mec1-HA методом совместной иммунопреципитации. Подобно белку Pie1-myc дикого типа, мутантный белок Pie1-KA-myc соосаждается с Mec1-HA (рис.С). Известно, что некоторые короткие аминокислотные последовательности, богатые основными аминокислотами лизином и аргинином, функционируют как сигнал ядерной локализации (11). Возможно, что мутация pie1-KA может вызывать неправильную локализацию Pie1 вместе с Mec1. Поэтому мы исследовали внутриклеточное распределение Mec1 и Pie1 в клетках дикого типа и мутантных клетках pie1-KA (рис. 1). Экстракты цельных клеток разделяли на две отдельные цитоплазматическую и ядерную фракции. Равные объемы этих фракций и цельноклеточного экстракта анализировали с помощью иммуноблотов для выявления белков Mec1-HA и Pie1-myc.В качестве контроля фракционирования мы оценивали каждую фракцию на наличие цитоплазматического белка теплового шока Ssb1 и белка комплекса ядерной поры (4). Было обнаружено, что как Mec1-HA, так и Pie1-myc существуют как в цитоплазматической, так и в ядерной фракциях клеток дикого типа. Мутация pie1-KA не влияла на их внутриклеточное распределение. Более того, внутриклеточное распределение Mec1-HA существенно не менялось у мутантов pie1Δ (Fig. 11). Эти результаты показывают, что область внутри Pie1, которая гомологична Rad26 и UVSD, важна для функции Pie1, но не важна для ее взаимодействия с Mec1 или для внутриклеточной локализации Pie1 и Mec1.

Влияние мутации pie1-KA на внутриклеточное распределение Mec1 и Pie1. Клетки MEC1-HA pie1Δ sml1Δ (KSC1286), несущие YCpT-PIE-myc, YCpT-PIE1-KA-myc или контрольный вектор YCplac22, собирали и сферопластизировали. Сферопласты гомогенизировали для получения экстрактов цельных клеток (W), а затем разделяли на цитоплазматическую (C) и ядерную (N) фракции. Образцы из каждой фракции разделяли с помощью SDS-PAGE и подвергали иммуноблотингу с антителами против HA, против myc, против Ssb1 или против комплекса ядерных пор (NPC).

Влияние мутации
pie1Δ на активность киназы Mec1.

Члены семейства ATR, например, ATR и Rad3, обладают активностью протеинкиназы. Возможно, Mec1, как и другие члены семейства, обладает киназной активностью и что эта киназная активность контролируется Pie1. Mec1 содержит мотив DXXXXN в положениях с 2224 по 2229, который в обычных протеинкиназах играет критическую роль в катализе (49). Поэтому мы сконструировали киназоотрицательную мутацию ( mec1-KN ) путем замены аминокислот в консервативном мотиве DXXXXN на SXXXXS.ATM и ATR фосфорилируют кластерный домен серин-глутамин/треонин-глутамин (SQ/TQ) на Chk2, гомологе Rad53 у млекопитающих, in vitro (29). Rad53 считается нижележащей мишенью Mec1 (36, 42) и имеет 16 мотивов SQ/TQ; 7 из них расположены на амино-конце, 1 — в киназном домене и 8 — на карбоксильном конце. Поэтому мы использовали слитый белок, состоящий из GST и карбоксильного конца Rad53 (GST-Rad53), в качестве субстрата. Экстракты готовили из клеток, несущих YEp-Mec1-HA, YEp-MEC1-KN-HA или контрольный вектор.Белки Mec1-HA или Mec1-KN-HA иммунопреципитировали из этих экстрактов антителами против HA и подвергали киназному анализу. GST-Rad53 фосфорилировался с помощью Mec1-HA, тогда как фосфорилирование с помощью Mec1-KN-HA было сходно с фоновым уровнем в отсутствие белков, меченных HA (рис. A). GST сам по себе не был эффективно фосфорилирован Mec1-HA (данные не показаны). Эти результаты показывают, что Mec1 обладает ассоциированной киназной активностью по фосфорилированию карбоксильного конца Rad53. Мы обнаружили, что мутация mec1-KN демонстрирует фенотип, очень похожий на нулевую мутацию; эта мутация не дополняет клетки mec1Δ sml1Δ в отношении чувствительности к HU, MMS или УФ-свету, а также не дополняет летальность мутации mec1Δ (данные не показаны).Вместе эти результаты показывают, что активность киназы Mec1 необходима для контроля контрольных точек и роста клеток. Поскольку Rad53 активируется после повреждения ДНК Mec1-зависимым образом, мы исследовали, увеличивает ли повреждение ДНК киназную активность Mec1 из клеток MEC1-HA , в которых хромосомный ген MEC1 заменен меченой конструкцией. Однако лечение MMS не влияло на активность Mec1-ассоциированной протеинкиназы (рис. B). Поскольку Pie1 функционирует в комплексе с Mec1, мы также спросили, необходим ли Pie1 для активности киназы Mec1.Мы исследовали киназную активность, связанную с Mec1, полученным из клеток MEC1-HA PIE1 sml1Δ и MEC1-HA pie1Δ sml1Δ . Однако фосфорилирование GST-Rad53 не снижалось в экстрактах из клеток pie1Δ sml1Δ по сравнению с таковым в экстрактах из клеток PIE1 sml1Δ (рис. В). Эти результаты предполагают, что, хотя Pie1 играет существенную роль в ответах контрольных точек и росте клеток, его роль включает функции, отличные от регуляции активности киназы Mec1.

Активность протеинкиназы, связанная с Mec1. Клетки, выращенные до средней логарифмической фазы, инкубировали с 0,1% MMS или без него в течение 1 ч и собирали для приготовления неочищенных экстрактов. Экстракты подвергали иммунопреципитации антителами против НА. Иммунопреципитированные белки Mec1 с меткой HA анализировали на киназную активность с использованием GST-Rad53 в качестве субстрата, как описано в разделе «Материалы и методы». На верхней панели с помощью авторадиографии было обнаружено включение 32 P в GST-Rad53.На нижней панели количество белка Mec1, используемого для анализа киназы, исследовали с помощью иммуноблоттинга. (A) клетки mec1-1 sml1-1 (KSC783), несущие YEp-MEC1-HA (WT), YEp-MEC1-KN-HA (KN) или контрольный вектор pRS426 (-), (B) MMS- обработанные (+) или необработанные (-) клетки sml1Δ (KSC1178) и MEC1-HA sml1Δ (KSC1215); (C) Клетки MEC1-HA sml1Δ (KSC1215) и MEC1-HA pie1Δ sml1Δ (KSC1286).

ОБСУЖДЕНИЕ

Генетические исследования показали, что Mec1 играет критическую роль в реакциях контрольных точек и росте клеток у почкующихся дрожжей.Однако неясно, как Mec1 регулируется другими белками в ответах контрольных точек и росте клеток. Пытаясь ответить на этот вопрос, мы провели скрининг белков, которые связаны с Mec1 в двухгибридной системе, и идентифицировали PIE1/YDR499. Последующий эксперимент по коиммунопреципитации показал, что Pie1 физически взаимодействует с Mec1 in vivo. В этой статье мы приводим доказательства, демонстрирующие, что Pie1 играет критическую роль в ответах контрольных точек и росте клеток, взаимодействуя с Mec1.Во-первых, подобно mec1Δ , мутация pie1Δ летальна, и ее летальность подавляется мутациями sml1Δ . Летальность двойных мутантов mec1Δ pie1Δ также подавляется мутациями sml1Δ . Tel1 играет перекрывающуюся роль с Mec1, и высокая доза TEL1 может подавлять летальность у мутантов mec1Δ и pie1Δ (ссылка 30 и данные не показаны). Во-вторых, клетки pie1Δ sml1Δ демонстрируют такую ​​же чувствительность, что и клетки mec1Δ sml1Δ после повреждения ДНК и обработки HU.Кроме того, мутации mec1 и pie1 не являются аддитивными в отношении чувствительности к повреждению ДНК и лечению HU. В-третьих, клетки pie1Δ и mec1Δ одинаково дефектны по всем контрольным точкам повреждения и блока репликации G 1 , S и G 2 /M. Наконец, Rad53 гиперфосфорилируется после повреждения ДНК и блокады репликации, и это фосфорилирование зависит как от Pie1, так и от Mec1. Таким образом, мутанты mec1Δ и pie1Δ имеют идентичные фенотипы, что указывает на то, что Mec1 и Pie1 функционируют путем образования комплекса в ответах контрольных точек и росте клеток.Последовательно Paciotti et al. (32) и Rouse and Jackson (34) охарактеризовали YDR499 , обозначенные как DDC2 и LCD1 соответственно, и показали, что Pie1/Ddc2/Lcd1 взаимодействует с Mec1 и играет ключевую регулирующую роль в ответах контрольных точек и росте клеток. .

Чтобы понять регуляторную роль Pie1, мы исследовали, имеет ли Mec1 ассоциированную киназную активность и регулируется ли эта киназная активность Pie1. Сначала мы сконструировали киназоотрицательное производное MEC1 ( mec1-KN ).Было обнаружено, что мутация mec1-KN напоминает нулевую мутацию, поскольку она не дополняет летальность мутации mec1 Δ и чувствительность мутантов mec1 Δ к HU, MMS и УФ-свету. В соответствии с гипотезой о том, что Rad53 функционирует ниже Mec1, существует киназная активность, связанная с Mec1 дикого типа, которая может фосфорилировать белок Rad53. Киназоотрицательное производное Mec1 (Mec1-KN) не может фосфорилировать белок Rad53. Эти результаты предполагают, что активность киназы Mec1 важна для роли Mec1 в ответах контрольных точек и росте клеток.Однако активность Mec1 по фосфорилированию белка Rad53 in vitro не зависит от повреждения ДНК, хотя для фосфорилирования Rad53 после повреждения ДНК требуется Mec1 in vivo. Более того, активность киназы Mec1 in vitro не изменяется при делеции PIE1 , хотя мутанты mec1 Δ и pie1 Δ обнаруживают идентичные фенотипы. Mec1 существует как в ядре, так и в цитоплазме, но мутация pie1 Δ существенно не влияет на внутриклеточную локализацию Mec1.До сих пор мы не получили результатов, демонстрирующих регуляторную роль Pie1. Каталитический компонент ДНК-зависимой протеинкиназы (DNA-PKcs) также содержит домен киназы, структурно родственный домену фосфатидилинозитол-3-киназы, обнаруженному в белках семейства ATR (39). Хотя они и не участвуют в контроле контрольных точек, DNA-PKcs могут служить моделью для понимания регуляции белков семейства ATR. In vitro DNA-PKcs активируется путем связывания концов двухцепочечной ДНК в присутствии гетеродимера, состоящего из субъединиц Ku70 и Ku86.Таким образом, активация DNA-PKcs зависит как от специфических структур ДНК, так и от регуляторных кофакторов. Возможно, что Pie1 нацеливает Mec1 на специфические структуры ДНК и/или другие ДНК-связывающие белки, чтобы активировать активность киназы Mec1. Такая ДНК и/или белки могут отсутствовать в нашем анализе in vitro, так что активность киназы Mec1 не может быть затронута повреждением ДНК или делецией PIE1 . Альтернативно возможно, что Pie1 облегчает распознавание Mec1 специфических субстратов, участвующих в ответах контрольных точек и клеточной пролиферации.В этой модели субстраты для Mec1 могут модулироваться для узнавания с помощью Pie1, а затем эффективно фосфорилироваться с помощью Mec1. Напр., Rad9 гиперфосфорилирован и связывается с Rad53 в ответ на повреждение ДНК, и это взаимодействие Rad9-Rad53 вовлечено в активацию Rad53 (14, 43, 45). Mec1 может эффективно фосфорилировать Rad53 только тогда, когда он связан с Rad9. Наконец, остается возможным, что Mec1 фосфорилирует Pie1 и этот фосфорилированный Pie1, в свою очередь, передает сигнал вниз по течению в реакциях клеточного роста и контрольных точек.Пачотти и др. (32) показали, что Pie1/Ddc2 фосфорилируется с помощью Mec1 после повреждения ДНК и блокады репликации, хотя значимость фосфорилирования не была продемонстрирована.

Pie1 имеет несколько общих функциональных свойств с делящимися дрожжами Rad26. Делеционная мутация rad26 вызывает тот же дефект контрольной точки, что и делеционная мутация rad3 . Rad26 физически взаимодействует с белком Rad3 семейства ATR и подвергается Rad3-зависимому фосфорилированию, вызванному повреждением ДНК (12).У A. nidulans мутации в uvsD придают фенотипы, сходные с мутациями члена семейства ATR uvsB (40). Биохимические свойства белков UVSB и UVSD еще не исследованы. В дополнение к этим функциональным сходствам, как Rad26, так и белки UVSD имеют ограниченную гомологию с Pie1 (1, 40). Чтобы изучить значение консервативной области среди этих белков, мы заменили два консервативных основных аминокислотных остатка в этой области Pie1 аланинами.Полученная мутация pie1-KA была очень похожа на нулевую мутацию pie1 в отношении роста клеток и чувствительности к HU, MMS и УФ-излучению. Эти результаты показывают, что эта гомологичная область необходима для функции Pie1, и предполагают, что белки Pie1, Rad26 и UVSD функционально и структурно родственны друг другу. Поэтому мы ожидаем, что гомологи Pie1, Rad26 и UVSD будут обнаружены у высших эукариот. У D. melanogaster были идентифицированы мутации в mus304 , вызывающие те же дефекты контрольных точек, что и мутации в члене семейства ATR mei-41 (7).Кроме того, было показано, что mus304 и mei-41 действуют по одному и тому же генетическому пути во время репарации и развития ДНК (7). Хотя поиски не выявили конкретной гомологии последовательностей, mus304 кодирует белок с размером, подобным Pie1 и Rad26, и с участком из 4 основных аминокислотных остатков в соответствующем регионе. Mus304 может быть белком, родственным Pie1.

Члены семейства ATR представляют собой структурно и функционально родственные белки, обнаруженные в самых разных организмах (6).Все эти большие белки содержат высококонсервативный киназный домен на карбоксильном конце и центральную область, которая демонстрирует значительную гомологию. В Mec1 ни одна из этих гомологичных областей не требуется для взаимодействия с Pie1. Однако было обнаружено, что амино-концевой Mec1, который не проявляет явной гомологии с соответствующей областью других членов семейства ATR, необходим для взаимодействия с Pie1. Неудивительно, что мы также обнаружили, что карбоксильный конец Pie1, который также не проявляет явной гомологии с Rad26 и UVSD, необходим для взаимодействия с Mec1.Возможно, Rad26 и UVSD взаимодействуют с аминоконцом Rad3 и UVSB соответственно. Чтобы понять роль консервативной области Pie1, мы исследовали, влияет ли мутация pie1-KA на ее взаимодействие с Mec1 или на внутриклеточную локализацию Mec1 и Pie1. Однако ни один из них не был затронут мутацией pie-KA . Эти результаты показывают, что эта гомологичная область важна для функций Pie1, отличных от ее взаимодействия с Mec1 или внутриклеточной локализации.Поэтому будет интересно рассмотреть другие аспекты, например, может ли Pie1 взаимодействовать со специфическими структурами ДНК и/или др. белками контрольных точек через эту область.

Таким образом, мы идентифицировали Pie1 как белок, который физически взаимодействует с Mec1, и показали, что Pie1 и Mec1 функционируют как комплекс, необходимый для ответов контрольных точек и роста клеток. Наш результат также предполагает, что Pie1 является гомологом Rad26 и UVSD и что консервативная область среди этих трех белков необходима для функции Pie1.Однако еще предстоит точно определить, как Pie1 регулирует активность Mec1. Будущая работа будет сосредоточена на взаимодействии комплекса Mec1-Pie1 со специфическими структурами ДНК и/или другими белками контрольных точек в ответах контрольных точек.

БЛАГОДАРНОСТЬ

Т.В. и Т.К. в равной мере внесли свой вклад в эту работу.

Мы благодарим Т. Найки за первоначальный отбор двух гибридов; Х. Огава, П. Джеймс и С. Нишикава за материалы; T. Yoshihisa за технические предложения и M. Lamphier за критические прочтения рукописи.Мы также благодарим Джона Роуза и Стива Джексона за сообщение результатов перед публикацией.

Т.К. является получателем преддокторской стипендии JSPS. Эта работа была поддержана грантом на научные исследования в приоритетных областях и общих исследований от Министерства образования, науки, спорта и культуры Японии (KM и KS).

ССЫЛКИ

1. AI-Khodairy F, Fotou E, Sheldrick KS, Griffiths DJF, Lehmann AR, Carr AM. Идентификация новых элементов, участвующих в контрольных точках и обратной связи у делящихся дрожжей.Мол Биол Селл. 1994; 4: 147–160. [Бесплатная статья PMC] [PubMed] [Google Scholar]2. Аллен Дж. Б., Чжоу З., Сиде В., Фридберг Э. С., Элледж С. Дж. Протеинкиназа SAD1/RAD53 контролирует несколько контрольных точек и транскрипцию, вызванную повреждением ДНК, у дрожжей. Гены Дев. 1994; 8: 2416–2428. [PubMed] [Google Scholar]3. Арис Дж. П., Блобель Г. Выделение ядер дрожжей. Методы Энзимол. 1991; 194: 735–749. [PubMed] [Google Scholar]4. Арис Дж. П., Блобель Г. Белки ядерной оболочки дрожжей перекрестно реагируют с антителами против белков порового комплекса млекопитающих.Джей Селл Биол. 1989; 108: 2059–2067. [Бесплатная статья PMC] [PubMed] [Google Scholar]5. Банин С., Мойал Л., Ши С., Тая Й., Андерсон С.В., Чесса Л., Смородинский Н.И., Привес С., Рейсс Й., Шайлох Й., Зив Й. Усиленное фосфорилирование р53 с помощью АТМ в ответ на повреждение ДНК. Наука. 1998; 281:1674–1677. [PubMed] [Google Scholar]6. Bentley NJ, Holtzman DA, Flaggs G, Keegan KS, Demaggio A, Ford JC, Hoekstra M, Carr AM. Ген контрольной точки Schizosaccharomyces pombe rad3 . EMBO J. 1996; 15: 6641–6651.[Бесплатная статья PMC] [PubMed] [Google Scholar]7. Brodsky M H, Sekelsky J J, Tsang G, Hawley R S, Rubin G M. mus304 кодирует новый белок контрольной точки повреждения ДНК, необходимый во время развития Drosophila . Гены Дев. 2000; 14: 668–678. [Бесплатная статья PMC] [PubMed] [Google Scholar]8. Canman CE, Lim DS, Cimprich KA, Taya Y, Tamai K, Sakaguchi K, Appella E, Kastan MB, Siliciano JD. Активация киназы ATM ионизирующим излучением и фосфорилированием p53. Наука. 1998; 281:1677–1679.[PubMed] [Google Scholar]9. Карр А.М. Контроль остановки клеточного цикла с помощью пути контрольной точки структуры ДНК Mec1sc/Rad3sp. Curr Opin Genet Dev. 1997; 7: 93–98. [PubMed] [Google Scholar] 10. Десани Б.Д., Алькасабас А.А., Бачант Дж.Б., Элледж С.Дж. Восстановление после стресса репликации ДНК является важной функцией пути контрольной точки S-фазы. Гены Дев. 1998; 12:2956–2970. [Бесплатная статья PMC] [PubMed] [Google Scholar]11. Dingwall C, Laskey RA. Ядерные таргетинговые последовательности — консенсус? Тенденции биохимических наук. 1991; 16: 478–481.[PubMed] [Google Scholar] 12. Эдвардс Р. Дж., Бентли Н. Дж., Карр А. М. Комплекс Rad3-Rad26 реагирует на повреждение ДНК независимо от других белков контрольных точек. Nat Cell Biol. 1999; 1: 393–398. [PubMed] [Google Scholar] 13. Элледж С. Дж. Контрольные точки клеточного цикла: предотвращение кризиса идентичности. Наука. 1996; 274:1664–1672. [PubMed] [Google Scholar] 14. Эмили А. MEC1-зависимое фосфорилирование Rad9p в ответ на повреждение ДНК. Мол Ячейка. 1998; 2: 183–189. [PubMed] [Google Scholar] 15. Гитц Р. Д., Сугино А. Новые челночные векторы дрожжей Escherichia coli , сконструированные с мутагенизированными in vitro генами дрожжей, лишенными сайтов рестрикции из шести пар оснований.Ген. 1988; 74: 527–534. [PubMed] [Google Scholar] 16. Green CM, Erdjument-Bromage H, Tempst P, Lowndes NF. Новый белковый комплекс контрольной точки Rad24, тесно связанный с фактором репликации C. Curr Biol. 2000; 10:39–42. [PubMed] [Google Scholar] 17. Гатри С., Финк Г. Р. Руководство по генетике дрожжей и молекулярной биологии. Нью-Йорк, штат Нью-Йорк: Academic Press, Inc.; 1991. [Google Scholar]18. Хари К.Л., Сантерре А., Секельски Дж.Дж., МакКим К.С., Бойд Дж.Б., Хоули Р.С. Ген mei-41 D. melanogaster является структурным и функциональным гомологом гена атаксии телеангиэктазии человека.Клетка. 1995; 82: 815–821. [PubMed] [Google Scholar] 19. Hartwell LH, Weinert TA. Контрольные точки: элементы управления, обеспечивающие порядок событий клеточного цикла. Наука. 1989; 246: 229–234. [PubMed] [Google Scholar] 20. Джеймс П., Халладей Дж., Крейг Э.А. Геномные библиотеки и штамм-хозяин, предназначенные для высокоэффективной двухгибридной селекции дрожжей. Генетика. 1996; 144:1425–1436. [Бесплатная статья PMC] [PubMed] [Google Scholar]21. Кайзер К., Михаэлис С., Митчелл А. Методы генетики дрожжей. Колд-Спринг-Харбор, Нью-Йорк: Лабораторное издательство Колд-Спринг-Харбор; 1994.[Google Академия] 22. Като Р., Огава Х. Существенный ген, ESR1 , необходим для митотического роста клеток, репарации ДНК и мейотической рекомбинации у Saccharomyces cerevisiae . Нуклеиновые Кислоты Res. 1994; 22:3104–3112. [Бесплатная статья PMC] [PubMed] [Google Scholar]23. Keegan KS, Holtzman DA, Plug AW, Christenson ER, Brainerd EE, Flaggs G, Bentley NJ, Taylor EM, Meyn MS, Moss SB, Carr AM, Ashley T, Hoekstra MF. Протеинкиназы Atr и Atm связываются с разными сайтами по мейотически спаривающимся хромосомам.Гены Дев. 1996; 10:2423–2437. [PubMed] [Google Scholar] 24. Кондо Т., Мацумото К., Сугимото К. Роль комплекса, содержащего Rad17, Mec3 и Ddc1, в пути контрольной точки повреждения ДНК дрожжей. Мол Селл Биол. 1999;19:1136–1143. [Бесплатная статья PMC] [PubMed] [Google Scholar]25. Longhese M P, Foiani M, Muzi-Falconi M, Lucchini G, Plevani P. Контрольная точка повреждения ДНК у почкующихся дрожжей. EMBO J. 1998; 17: 5525–5528. [Бесплатная статья PMC] [PubMed] [Google Scholar]26. Лонгезе М. П., Пачотти В., Фраскини Р., Дзаккарини Р., Плевани П., Луккини Г.Новый белок контрольной точки повреждения ДНК Ddc1p периодически фосфорилируется в течение клеточного цикла и в ответ на повреждение ДНК у почкующихся дрожжей. EMBO J. 1997; 17: 5216–5226. [Бесплатная статья PMC] [PubMed] [Google Scholar]27. Lydall D, Weinert T. Гены контрольных точек дрожжей в обработке повреждений ДНК: последствия для восстановления и ареста. Наука. 1995; 270:1488–1491. [PubMed] [Google Scholar] 28. Martinho RG, Lindsay HD, Flaggs G, DeMaggio AJ, Hoekstra MF, Carr AM, Bentley NJ. Анализ протеинкиназ Rad3 и Chk1 определяет различные ответы контрольных точек.EMBO J. 1998; 17: 7239–7249. [Бесплатная статья PMC] [PubMed] [Google Scholar]29. Мацуока С., Ротман Г., Огава А., Шайло Ю., Тамаи К., Элледж С. Дж. Фосфорилирует Chk2 с мутацией атаксии телеангиэктазии in vivo и in vitro. Proc Natl Acad Sci USA. 2000;97:10389–10394. [Бесплатная статья PMC] [PubMed] [Google Scholar]30. Morrow DM, Tagle DA, Shiloh Y, Collins FS, Hieter P. TEL1 , гомолог S. cerevisiae человеческого гена, мутировавшего при атаксии телеангиэктазии, функционально связан с геном контрольной точки дрожжей MEC1 .Клетка. 1995; 82: 831–840. [PubMed] [Google Scholar] 31. Naiki T, Shimomura T, Kondo T, Matsumoto K, Sugimoto K. Rfc5 в сотрудничестве с Rad24 контролирует контрольные точки повреждения ДНК на протяжении клеточного цикла в Saccharomyces cerevisiae . Мол Селл Биол. 2000;20:5888–5896. [Бесплатная статья PMC] [PubMed] [Google Scholar]32. Paciotti V, Clerici M, Lucchini G, Longhese MP. Белок контрольной точки Ddc2, функционально связанный с S. pombe Rad26, взаимодействует с Mec1 и регулируется Mec1-зависимым фосфорилированием у почкующихся дрожжей.Гены Дев. 2000;14:2046–2059. [Бесплатная статья PMC] [PubMed] [Google Scholar]33. Paciotti V, Lucchini G, Plevani P, Longhese M P. Mec1p необходим для фосфорилирования белка контрольной точки повреждения ДНК дрожжей Ddc1p, который физически взаимодействует с Mec3p. EMBO J. 1998; 17: 4199–4209. [Бесплатная статья PMC] [PubMed] [Google Scholar]34. Роуз Дж., Джексон С. П. LCD1 : важный ген, участвующий в контроле контрольных точек и регуляции сигнального пути MEC1 у Saccharomyces cerevisiae .EMBO J. 2000; 19: 5793–5800. [Бесплатная статья PMC] [PubMed] [Google Scholar]35. Sanchez Y, Bachant J, Wang H, Hu F, Liu D, Tetzlaff M, Elledge SJ. Контроль контрольной точки повреждения ДНК с помощью протеинкиназ Chk1 и Rad53 с помощью различных механизмов. Наука. 1999; 286:1166–1171. [PubMed] [Google Scholar] 36. Sanchez Y, Desany BA, Jones W J, Liu Q, Wang B, Elledge S J. Регулирование RAD53 с помощью ATM -подобной киназы MEC1 и TEL1 в путях контрольных точек клеточного цикла дрожжей.Наука. 1996; 271:357–360. [PubMed] [Google Scholar] 37. Савицкий К., Бар-Шира А., Гилад С., Ротман Г., Зив Ю., Ванагайте Л., Тагле Д.А., Смит С., Узиэль Т., Сфес С., Ашкенази М., Пекер И., Фридман М., Харник Р., Патанаджали С.Р., Симмонс А., Clines GA, Sartiel A, Gatti RA, Chessa L, Sanal O, Lavin MF, Jaspers NGJ, Taylor AMR, Arlett CF, Miki T, Weissman SM, Lovett M, Collins FS, Shiloh Y. Единственный ген атаксии и телеангиэктазии с продуктом похож на киназу PI-3. Наука. 1995; 268:1749–1753. [PubMed] [Google Scholar] 38.Симомура Т., Андо С., Мацумото К., Сугимото К. Функциональное и физическое взаимодействие между Rad24 и Rfc5 в путях контрольных точек дрожжей. Мол Селл Биол. 1998;18:5485–5491. [Бесплатная статья PMC] [PubMed] [Google Scholar]39. Smith GCM, Jackson SP. ДНК-зависимая протеинкиназа. Гены Дев. 1999; 13: 916–934. [PubMed] [Google Scholar]40. Souza CPC D, Ye X S, Osmani S A. Дефекты контрольных точек, ведущие к преждевременному митозу, также вызывают эндорепликацию ДНК в Aspergillus nidulans . Мол Биол Селл.1999; 10:3661–3674. [Бесплатная статья PMC] [PubMed] [Google Scholar]41. Sugimoto K, Ando S, Shimomura T, Matsumoto K. Rfc5, компонент фактора репликации C, необходим для регуляции протеинкиназы Rad53 в пути контрольных точек дрожжей. Мол Селл Биол. 1997; 17: 5905–5914. [Бесплатная статья PMC] [PubMed] [Google Scholar]42. Sun Z, Fay DS, Marini F, Foiani M, Stern DF. Spk1/Rad53 регулируется Mec1-зависимым фосфорилированием белка в путях репликации ДНК и контрольных точек повреждения. Гены Дев. 1996; 10: 395–406.[PubMed] [Google Scholar]43. Sun Z, Hsiao J, Fay DS, Stern DF. Домен FHA Rad53, связанный с фосфорилированным Rad9 в контрольной точке повреждения ДНК. Наука. 1998; 281: 272–274. [PubMed] [Google Scholar]44. Утияма М., Галли И., Гриффитс Д.Дж. Ф., Ван Т. С.-Ф. Новый мутантный аллель Schizosaccharomyces pombe rad26 дефектен в контроле прогрессирования S-фазы для предотвращения преждевременного митоза. Мол Селл Биол. 1997; 17:3103–3115. [Бесплатная статья PMC] [PubMed] [Google Scholar]45. Виалард Дж. Э., Гилберт К. С., Грин К. М., Лаундс Н. Ф.Белок контрольной точки Rad9 почкующихся дрожжей подвергается Mec1/Tel1-зависимому гиперфосфорилированию и взаимодействует с Rad53 после повреждения ДНК. EMBO J. 1998; 17: 5679–5688. [Бесплатная статья PMC] [PubMed] [Google Scholar]47. Weinert TA, Hartwell LH. Ген RAD9 контролирует реакцию клеточного цикла на повреждение ДНК у Saccharomyces cerevisiae . Наука. 1988; 241:317–322. [PubMed] [Google Scholar]48. Weinert TA, Kiser GL, Hartwell LH. Митотические гены контрольных точек у почкующихся дрожжей и зависимость митоза от репликации и восстановления ДНК.Гены Дев. 1994; 8: 652–665. [PubMed] [Google Scholar]49. Закиан В. А. Гены, связанные с АТМ: что они говорят нам о функциях человеческого гена? Клетка. 1995; 82: 685–687. [PubMed] [Google Scholar]50. Чжао X, Мюллер Э. Г. Д., Ротштейн Р. Супрессор двух основных генов контрольных точек идентифицирует новый белок, который негативно влияет на пул dNTP. Мол Ячейка. 1998; 2: 329–340. [PubMed] [Google Scholar]

Datenblatt PDFsuche — Datenblätter

Teilenummer Рассылка Герстеллер ПДФ
XYC-PT5I850AC-A4 Технические характеристики изделий серии PT550
XYCCD
УПК1365С Процессор цветности и яркости PAL
НЭК
УПА1В822МПД АЛЮМИНИЕВЫЕ ЭЛЕКТРОЛИТИЧЕСКИЕ КОНДЕНСАТОРЫ
Нихикон
УПА1В821МПД АЛЮМИНИЕВЫЕ ЭЛЕКТРОЛИТИЧЕСКИЕ КОНДЕНСАТОРЫ
Нихикон
УПА1В682МПД АЛЮМИНИЕВЫЕ ЭЛЕКТРОЛИТИЧЕСКИЕ КОНДЕНСАТОРЫ
Нихикон
УПА1В681МПД АЛЮМИНИЕВЫЕ ЭЛЕКТРОЛИТИЧЕСКИЕ КОНДЕНСАТОРЫ
Нихикон
УПА1В562МПД АЛЮМИНИЕВЫЕ ЭЛЕКТРОЛИТИЧЕСКИЕ КОНДЕНСАТОРЫ
Нихикон
УПА1В561МПД АЛЮМИНИЕВЫЕ ЭЛЕКТРОЛИТИЧЕСКИЕ КОНДЕНСАТОРЫ
Нихикон
УПА1В472МПД АЛЮМИНИЕВЫЕ ЭЛЕКТРОЛИТИЧЕСКИЕ КОНДЕНСАТОРЫ
Нихикон
УПА1В471МПД АЛЮМИНИЕВЫЕ ЭЛЕКТРОЛИТИЧЕСКИЕ КОНДЕНСАТОРЫ
Нихикон
УПА1В332МПД АЛЮМИНИЕВЫЕ ЭЛЕКТРОЛИТИЧЕСКИЕ КОНДЕНСАТОРЫ
Нихикон
УПА1В272МПД АЛЮМИНИЕВЫЕ ЭЛЕКТРОЛИТИЧЕСКИЕ КОНДЕНСАТОРЫ
Нихикон

Мониторинг морфологии трещин и технология гидроразрыва пласта малой длины и большой ширины на месторождении сверхнизкой проницаемости

[1]

Абольфазл А., Марджи Ф.М., Бафги А.Ю., и др. .2015. Моделирование распространения трещин ГРП из круглого ствола скважины с использованием метода разрыва смещения[J]. Международный журнал горной механики и горных наук, 80:281-291, doi:10.1016/j.ijrmms.2015.10.004.

[2]

Fan T G, Zhang G Q. 2014. Лабораторное исследование сетей гидроразрывов пластов с непрерывными ортогональными трещинами [J].Energy, 74:164-173, doi:10.1016/j.energy.2014.05.037.

[3]

Gao PF, Xu L. 2016. Обсуждение технологии гидроразрыва пласта для увеличения добычи в низкопроницаемом коллекторе[J]. Технология нефтехимической промышленности (на китайском языке), 23 (6): 286.

[4]

Гоу Х.Б., Лю З.С., Бао З.Л.2011. Положительная несшитая технология гидроразрыва пласта Чанг 6 нефтяного месторождения Чуанкоу[J]. Нефтяные инструменты (на китайском языке), 25 (3): 64-66.

[5]

Хуан Дж., Сафари Р., Мутлу У., и др. . 2015. Взаимодействие естественных гидроразрывов: микросейсмические наблюдения и геомеханические прогнозы[J]. Интерпретация, 3(3):SU17-SU31, doi:10.1190/INT-2014-0233.1.

[6]

Хуан С. М., Ван Дж. И., Чен С. Г., и др. . 2016. Простая модель расширения-переуплотнения для гидроразрыва пласта[J]. Журнал нетрадиционных ресурсов нефти и газа, 16:62-75, doi:10.1016/j.juogr.2016.09.006.

[7]

Li J L, Li C, Morton SA, и др. .2014. Расположение микросейсмических трещин и инверсия анизотропной скорости для гидроразрыва пласта в плотной Баккенской залежи [J]. Геофизика, 79(5):C111-C122, doi:10.1190/geo2013-0345.1.

[8]

Li M, Xia Y J, Fu H F, и др. . 2016. Трехмерное численное моделирование процесса гидроразрыва пласта при рулевом напряжении [J].China Sciencepaper (на китайском языке), 11(3):286-291.

[9]

Liu Z S, Huang B, Ma H Z. 2016. Применение технологии оборотного гидроразрыва пласта на нефтяном месторождении Чуанкоу, бассейн Ордос [J]. Нетрадиционная нефть и газ (на китайском языке), 3(1):66-70.

[10]

Мышакин Э., Сиривардане Х., Халчер С., и др. .2015. Численное моделирование вертикального роста гидроразрывов и миграции рассола в геологических формациях над сланцами Марцеллус[J]. Журнал науки и техники о природном газе, 27:531-544, doi:10.1016/j.jngse.2015.08.030.

[11]

Peng T S, Liu Q, He X, и др. . 2011. Применение технологии испытаний стереоскопического гидроразрыва пласта в режиме реального времени при гидроразрыве пласта [J].Журнал нефтехимических университетов (на китайском языке), 24 (3): 47-51.

[12]

Rodríguez-Pradilla G. 2015. Микросейсмический мониторинг операции гидроразрыва пласта угольного пласта: тематическое исследование формации Cerrejón, бассейн Cesar-Ranchería, Колумбия[J]. The Leading Edge, 34(8):896-902, doi:10.1190/tle34080896.1.

[13]

Sobhaniaragh B, Mansur WJ, Peters FC. 2016. Трехмерное исследование многостадийного гидроразрыва пласта в нетрадиционных коллекторах[J]. Журнал нефтяной науки и техники, 146:1063-1078, doi:10.1016/j.petrol.2016.07.019.

[14]

Tang H Y, Winterfeld P H, Wu Y S, и др. .2016. Комплексное моделирование многостадийного гидроразрыва пласта в нетрадиционных коллекторах[J]. Журнал науки и техники о природном газе, 36:875-892, doi:10.1016/j.jngse.2016.11.018.

[15]

Waldron AR, Camac BA. 2016. Микросейсмический мониторинг программ гидроразрыва пласта в бассейне Купера, Австралия[J].The Leading Edge, 35(1):72-76, doi:10.1190/tle35010072.1.

[16]

Ван С.Дж., Лю Дж.В., Гао Х.Х., и др. . 2011. Применение метода внутрискважинного микросейсмического мониторинга трещин в вулканическом резервуаре[J]. Tuha Oil & Gas (на китайском языке), 16(1):24-26, 36.

[17]

Ван X Z, Ли Дж, Чжан Л.2011. Исследование морфологических характеристик и основных контролирующих факторов искусственных трещин на нефтяном месторождении Чуанкоу[J]. Журнал Яньаньского университета (издание естественных наук) (на китайском языке), 30 (1): 69-73.

[18]

Wang Z Z, Deng J G, Zhao Z F, и др. .2006. Схема внутрискважинного микросейсмического мониторинга трещин и анализ результатов гидроразрыва[J].Нефтяная геология и разработка нефтяных месторождений в Дацине (на китайском языке), 25 (6): 76-78.

[19]

Wei HC, Li L G, Wu X M, и др. . 2011. Анализ и теоретическое исследование фактора множественных трещин при ГРП скважин МУП[J]. Procedia Earth and Planetary Science, 3:231-237, doi:10.1016/j.пропс.2011.09.088.

[20]

Wu Y J, Guo H, Wang J N, и др. . 2014. Изучение микроскопической структуры пор пласта Чанг 6 на нефтяном месторождении Яодянь, бассейн Ордос[J]. Нефтехимическая промышленность Внутренней Монголии (на китайском языке), (2): 129-132.

[21]

Yang Y J, Zhang L, Zhao Y, и др. .2000. Характеристика и влияние трещин на заводнение в нефтяном пласте Чанг № 6 нефтяного месторождения Чуанкоу [J]. Северо-западная геология (на китайском языке), 33 (2): 22-26.

[22]

Zecevic M, Daniel G, Jurick D. 2016. О характере долговременных сейсмических событий, обнаруженных во время гидроразрыва пласта[J].Геофизика, 81(3):KS113-KS121, doi:10.1190/geo2015-0524.1.

[23]

Zeeb C, Konietzky H. 2015. Моделирование гидравлического воздействия на множественные трещины в анизотропном поле напряжений с применением метода дискретных элементов[J]. Energy Procedia, 76:264-272, doi:10.1016/j.egypro.2015.07.859.

[24]

Чжан К., Го Y X, Чжан Б., и др. .2013. Сейсмический анализ азимутальной анизотропии после гидроразрыва пласта [J]. Интерпретация, 1(2):SB27-SB36, doi:10.1190/INT-2013-0013.1.

[25]

Чжан Л., Ян И.Дж., Чжан И.Л., и др. . 2002. Характеристики трещин низкопроницаемого коллектора Чанг-6 на нефтяном месторождении Чуанкоу, бассейн Шань-Гань-Нин[J].Northwestern Geology(in Chinese), 35(2):41-45.

[26]

Zheng A P, Liu Q, Tian Y P, et al . 2012. Hydraulic fracturing evaluation with microseismic monitoring technique for shallow carboniferous volcanic rock reservoirs[J]. Special Oil and Gas Reservoirs (in Chinese), 19(1):120-123.

[27]

附中文参考文献

[28]

高鹏飞, 许亮.2016. 低渗透油层增效压裂技术探讨[J]. 石化技术, 23(6):286.

[29]

李明, 夏英杰, 付海峰,等. 2016. 应力转向条件下水力压裂的三维数值模拟分析[J]. 中国科技论文, 11(3):286-291.

[30]

刘政帅, 黄博, 马洪志.2016. 转向压裂技术在鄂尔多斯盆地川口油田的应用[J]. 非常规油气, 3(1):66-70.

[31]

彭通曙, 刘强, 何欣,等. 2011. 立体裂缝实时监测技术在油藏水力压裂中的应用[J]. 石油化工高等学校学报, 24(3):47-51.

[32]

王树军, 刘建伟,.高浩宏,等. 2011. 井下微地震裂缝监测技术在火山岩压裂中的应用[J]. 吐哈油气, 16(1):24-26, 36.

[33]

王旭庄,李江, 张蔺. 2011. 川口油田人工裂缝形态特征及其主控因素研究[J]. 延安大学学报(自然科学版), 30(1):69-73.

[34]

王治中, 邓金根, 赵振峰,等.2006. 井下微地震裂缝监测设计及压裂效果评价[J]. 大庆石油地质与开发, 25(6):76-78.

[35]

吴彦君, 郭华, 王建宁,等. 2014. 鄂尔多斯盆地姚店油田长6油层微观孔隙结构研究[J]. 内蒙古石油化工, (2):129-132.

[36]

杨亚娟, 张莉, 赵阳,等.2000. 川口油田长 6 油层裂缝特征及对注水开发的影响[J]. 西北地质, 33(2):22-26.

[37]

张莉, 杨亚娟, 张玉玲,等. 2002. 陕甘宁盆地川口油田低渗透油藏长6油层裂缝特征[J]. 西北地质, 35(2):41-45.

[38]

郑爱萍, 刘强, 田永鹏,等.2012. 微地震水力压裂监测技术在浅层石炭系火山岩油藏中的应用[J]. 特种油气藏, 19(1):120-123.

[39]

缑海兵, 刘政帅, 鲍志琳. 2011. 川口油田长6油层非交联正电胶水力压裂[J]. 石油仪器, 25(3):64-66.

Regulation of Cell Polarity by Microtubules in Fission Yeast | Journal of Cell Biology

In fission yeast, actin is highly enriched at sites of polarized growth (Marks et al., 1986). Мы использовали модифицированный метод окраски родамином-фаллоидином (Marks and Hyams, 1985) для анализа изменений F-актинового цитоскелета, сопутствующих переориентации поляризованного роста (см. Материалы и методы). Как описано ранее, в G1-задержанных клетках cdc10-129 , которые были заблокированы перед NETO, актин был сильно поляризован до одного растущего конца; это «старый» конец, существовавший ранее в материнской клетке, а не «новый» конец, созданный самым последним клеточным делением, который остается бездействующим до NETO (Marks and Hyams, 1985; Mitchison and Nurse, 1985).Актиновые точки плотно прилегали к клеточной поверхности, и во многих случаях актиновые тяжи были направлены в конец (рис. 6, A–D ). Напротив, через 30 минут в TBZ (т. е. во время сдвига вниз) организация актина значительно изменилась. Актиновые точки были либо рандомизированы по клеткам, либо, если они все еще находились вблизи концов клеток, больше не были тесно связаны с клеточной корой (Fig. 6, E-H ). Актиновые тяжи все еще можно было наблюдать, но они больше не были сильно направлены к концам клеток (не показано).Через 1–1,5 ч после сдвига вниз мы наблюдали небольшие участки актиновых точек в середине клеток (рис. 6, I–L ), примерно в той же доле клеток, которая позже образует ветви (29/100 клеток). Через 2 часа после сдвига вниз стало очевидным восстановление актина в крайней клеточной коре с увеличением актина на концах ветвей, а также на одном или обоих концах ранее существовавших клеток как в разветвленных, так и в неразветвленных клетках (рис. 6, M–P (см. также рис. 8). Отметим, что в эти сроки остаточные микротрубочки остаются далеко от концов клеток (см.4, E′ ). Через 3 ч актин в разветвленных клетках, по-видимому, увеличился на концах клеток, а также на ветвях, и во многих случаях актиновые тяжи были сильно выражены, что, возможно, указывает на участие в перераспределении актина. В это же время мы также могли наблюдать начало образования актинового кольца в контрольных клетках, обработанных ДМСО (не показано). К 4 часам после сдвига вниз многие клетки в TBZ также начали разделяться (см. Chang et al., 1996), часто создавая аберрантные актиновые кольца, отражающие их разветвленную морфологию (рис.6, U–X ).

Распространение коркового актина вскоре после добавления TBZ было поразительным, и поэтому его дополнительно исследовали на штаммах дикого типа, cdc10-129 и cdc25-22 , а также на двойных мутантах cdc10-129 nda3-TB101 , оценивая неразветвленные клетки вместе с разветвленными клетками. У всех штаммов nda3 + мы наблюдали нарушение глобальной организации актина, в большинстве случаев в течение 30 мин после добавления ТБЗ (рис.7, A ), в то время как у двойного мутанта cdc10 nda3 была очевидна лишь умеренная потеря организации актина, что согласуется с эффектами на распределение микротрубочек, описанными выше. (В эксперименте, показанном на рис. 7, A , клетки дикого типа дезорганизовались медленнее, но это не всегда воспроизводилось; например, см. рис. 7, B .) Восстановление актина в коре в присутствие TBZ также наблюдалось во всех штаммах, хотя, по-видимому, медленнее у мутантов cdc10 , и иногда, когда у мутантов cdc10 можно было увидеть актиновые пятна в середине клетки (рис.6, I–L ), основная масса коркового актина оставалась дезорганизованной (рис. 7, A ). Мы также исследовали, было ли разрушение актина тиабендазолом специфичным для температурных сдвигов, использованных в наших экспериментах, с использованием экспоненциально растущих клеток дикого типа и мутантов cdc10-129 . Во всех протестированных условиях актин нарушался в течение примерно 30 минут после добавления TBZ, независимо от температуры и состояния клеточного цикла (фиг. 7  B ).

При количественной оценке возвращения актина в кору мы заметили, что большинство клеток на ранних стадиях ветвления содержали заметные количества актина только на «конце ветвления» или на конце ветвления и еще одном конце, в то время как в более поздние сроки разветвленные клетки может накапливать актин на всех трех концах (рис.7, С ; см. также рис. 6, M–V ). Чтобы определить, действительно ли актин, обычно обнаруживаемый на старых концах клеток до добавления NETO и TBZ, возвращается к старым концам во время восстановления в коре клеток, мы окрашивали окрашенные родамином-фаллоидином cdc10-129 клеток с помощью Calcofluor. Родовые рубцы, образовавшиеся в результате образования перегородки, плохо окрашиваются Calcofluor, и поскольку новые концы начинают рост позже, чем старые, новый конец клетки можно идентифицировать как конец, ближайший к родовому рубцу (Streiblova and Wolf, 1972; Mitchison and Nurse, 1985).Интересно, что в клетках, содержащих актин на ответвлении и на одном дополнительном конце, это оказалось либо старым концом, либо новым концом примерно в равной степени (28/52 клеток против 24/52 клеток соответственно; рис. 8, А). -D ), предполагая, что после нарушения актина и других компонентов коры под действием TBZ (см. ниже) сигналы, определяющие предпочтение роста на старых концах по сравнению с новыми, эффективно рандомизируются. Эта точка зрения также подтверждается паттернами окрашивания актина и Calcofluor в неветвящихся клетках.Среди клеток с актином на одном конце это очень часто был новый конец (35/100 клеток; рис. 8, E-H ), тогда как в контрольных клетках, обработанных ДМСО, мы никогда не наблюдали актин только на новом конце. (0/100 ячеек).

Список уникальных вариантов De novo a, идентифицированных NGS

Контекст 1

… полученный пул использовали для эмПЦР и подготовки гранул с помощью системы EZbead (Life Technologies) и для последующего секвенирования с помощью системы SOLiD 4 ( Технологии жизни).Картирование и вызов вариантов выполняли, как описано ранее (таблица S3). 13 Как для целевого, так и для экзомного секвенирования варианты и вставки были выбраны с использованием строгих настроек контроля качества, включая наличие не менее четырех (уникальных) прочтений вариантов и не менее 15% прочтений вариантов. …

Контекст 2

… эти шесть мутаций, ни одна из которых не наблюдалась в нашей внутренней базе данных секвенирования экзома (450 человек). Один, идентифицированный в POF1B на Х-хромосоме, был обнаружен один раз среди 8760 аллелей, зарегистрированных в базе данных Национального института сердца, легких и крови (NHLBI) (веб-ресурсы), которая содержит данные из более чем 5300 экзомов (> 10 600 аллелей). , оставив пять уникальных изменений de novo, выявленных в этом исследовании (таблица 3).Секвенирование KS113 KS47 KS35 KS94 KS129 Trio KS78 Trio KS220 Trio KS53 Trio KS49 Высоконадежные варианты вызовов 2 495 2 452 2 403 2 530 2 488 24 604 19 610 …

Контекст 3

… NGS индивидуального KS113 выявил нонсенс-мутацию (c.4441 C>T [p. Arg1481*]) в гене MLL3 миелоидного/лимфоидного или смешанной лейкемии 3 ( NM_170606.2) (Рисунок 1А, Таблица 3 и Рисунок S1A). Отец индивидуума KS113 умер, но мы смогли подтвердить отсутствие этой мутации у матери и двух здоровых сестер, каждая из которых несла тот же отцовский гаплотип в локусе MLL3, что и KS113 (рис. S2)….

Контекст 4

… одиночная миссенс-мутация SMARCB1 (c.110G>A [p.Arg37His]; NM_003073.3), предположительно вредная, была обнаружена с помощью целевого NGS у отдельных KS47 и была отсутствует у обоих родителей (Рисунок 1B, Таблица 3 и Рисунок S1B). Интересно, что недавно сообщалось, что мутации в этом гене, а также в нескольких других генах, которые кодируют белки комплекса SWI/SNF, вызывают синдром Coffin Siris (CSS [MIM ​​135900]). …

Контекст 5

… NM_018328.4), что приводит к преждевременному стоп-кодону (рис. 1C, таблица 3 и рисунок S1C). Делеции, охватывающие MBD5, а также внутригенные делеции MBD5 ранее были идентифицированы в случаях с фенотипом, напоминающим синдром Смита-Магениса, который характеризуется ДЗ, лицевыми дисморфизмами, эпилепсией и поведенческими проблемами. …

Контекст 6

… Анализ индивидуального KS220 (рис. 1D) выявил три мутации de novo (таблица S5), гетерозиготные носители не имеют явного фенотипа.29 Это оставляет два уникальных варианта de novo, один в MTMR9 и один в NR1I3 (Таблица 3). Изменение аминокислоты p.Ser104Ala, вызванное мутацией MTMR9, считается безопасным для PolyPhen-2 и переносимым SIFT. …

Контекст 7

… нокдаун snr1/SMARCB1 в крыле сам по себе вызывает крайне тяжелый фенотип, что исключает выводы о потенциальных генетических взаимодействиях с EHMT. Наконец, мы исследовали генетические взаимодействия с EcR/NR113 и CG5026/MTMR9, которые оба содержат миссенс-мутации de novo в отдельных KS220 (таблица 3).Количественная оценка образования эктопических жилок крыла (рис. 2G) не выявила влияния нокдауна CG5026/MTMR9 на фенотип сверхэкспрессии EHMT (рис. 2H), что согласуется с представлением о том, что мутация MTMR9 не вызывает KSS. …

%PDF-1.6 % 1 0 объект > /Метаданные 3 0 R /Контуры 4 0 R /Страницы 5 0 Р /StructTreeRoot 6 0 R /Тип /Каталог >> эндообъект 7 0 объект > эндообъект 2 0 объект > эндообъект 3 0 объект > ручей 2021-01-19T13:01:10+01:002021-01-19T13:01:10+01:002021-01-19T13:01:10+01:00Adobe Acrobat Pro DC 20.13.20074application/pdf

  • Кейт МакКаллум
  • uuid: 97fb17f6-e8a1-4106-bcdf-9d5841ea2da7uuid: ded125b7-d661-4c48-8dbb-0da180f34f46Adobe Acrobat Pro DC 20.13.20074 конечный поток эндообъект 4 0 объект > эндообъект 5 0 объект > эндообъект 6 0 объект > эндообъект 8 0 объект > /Повернуть 0 /Тип /Страница >> эндообъект 9 0 объект > /Повернуть 0 /Тип /Страница >> эндообъект 10 0 объект > /Повернуть 0 /Тип /Страница >> эндообъект 11 0 объект > /Повернуть 0 /Тип /Страница >> эндообъект 12 0 объект > /Повернуть 0 /Тип /Страница >> эндообъект 13 0 объект > /Повернуть 0 /Тип /Страница >> эндообъект 14 0 объект > /Повернуть 0 /Тип /Страница >> эндообъект 15 0 объект > /Повернуть 0 /Тип /Страница >> эндообъект 16 0 объект > /Повернуть 0 /Тип /Страница >> эндообъект 17 0 объект > эндообъект 18 0 объект > эндообъект 19 0 объект > эндообъект 20 0 объект > эндообъект 21 0 объект > эндообъект 22 0 объект > эндообъект 23 0 объект > эндообъект 24 0 объект > /Граница [0 0 1] /Прямо [196.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *