Кт819 характеристики: 819, 2819, kt819, 2t819 , ,

Содержание

Регулируемый блок питания 0-30В 5А на КТ819 [Архив] — LASERS.FONAREVKA.RU


Просмотр полной версии : Регулируемый блок питания 0-30В 5А на КТ819


Lum1noFor

18.02.2011, 12:59

Решил тут собрать себе простенький блок питания. Мои требования к нему были такие:

1. Регулируемый от 0 до 30 вольт.
2. Отдаваемый ток до 5А.
3. Обязательно транзисторный, ибо импульсную технику очень не люблю как по характеристикам, так и по сложности.
4. Не особо высокая сложность и дефицитность компонентов.

Долго копался в интернете, но ничего толкового так и не нашел. И тут знакомый посоветовал мне схему, взглянув на которую я понял — то, что нужно!

Вот собственно сама схема:
http://savepic.net/575686.gif

Основой данной конструкции послужил знаменитый ТН61, который очень ценится в радиолюбительских кругах за приличные характеристики и не особо огромные размеры.

Красными кругами на схеме я обозначал куски схемы (чисто для себя, просто кусок, ограниченный кругами очень удобно собирать навесом на самом радиаторе, а остальную схему — на плате).

После нескольких дней трудов был собран вот такой зверь:

http://savepic.net/524486.jpg
http://savepic.net/584921.jpg
http://savepic.net/586969.jpg

Для надежности я использовал давно валяющийся у меня мостик на 35 ампер и найденный в куче транзисторов КТ819АМ. Да, лучше брать именно КТ819xM, а не КТ819x, где x — буква. Лучше всего Г. Вторая буква М означает, что корпус у транзистора металлический, а не TO-220 — вероятно, вытянет и больше 5 ампер. Не пробовал.

В почти законченном виде выглядит так:
http://savepic.net/556249.jpg

И напоследок видео, как я насиловал галогенку на 35 ватт:

http://www.youtube.com/watch?v=6ivDE1ioNyo

Слишком медленное падение напряжения в холостом режиме обусловлено тем, что я переборщил с электролитом на выходе — поставил на 10 000 мкФ. На видео не видно, какой максимальный ток я на нее подавал — 4 А. Вопросы, как всегда, в эту тему.


Собрал себе БП по данной схеме вроде работает но греется R4 правильность сборки проверял не сколько раз собрал все правильно. конденсаторы на 2000 не нашел поставил по 1000. и выдает блок всего 20в


я давно такие собираю толька на LM350T А ТАК ПРОДАЁТСЯ платка с жк дисплеем так там более прикольно получается и поменьше в размере! а так из компового бп самое то!!


Lum1noFor

30.03.2012, 20:48

Собрал себе БП по данной схеме вроде работает но греется R4 правильность сборки проверял не сколько раз собрал все правильно. конденсаторы на 2000 не нашел поставил по 1000. и выдает блок всего 20в

R4 и должен греться, на то и написано, что 2 ватта. Как именно греется — не знаю, т.к. у меня стоит на 5 ватт (зеленый на фотке). Конденсатор на 2000 не критичен, главное, чтобы не на много меньше. Каким трансформатором питаете? Сколько вольт переменки на выходе транса? Какой максимальный ток обмоток выдает трансформатор?

P.S. У меня с ТН-61 35-37 вольт аж выдает. На видео это, кстати, видно.


R4 я тож мощный поставил греется при подключении лампы h5. но не горит норм. ток меж лампой и блоком на максе 3А. транс с кокого то кинотеатра довольно большой. переменки выдает 25 вольт. максим. ток обмоток не знаю. и еще если убавить ток регулятором до нуля то запускается транс примерна на 5 в. т.е когда с 0 прибавляешь 0показывает примерно до тех пор пока не станет 5в. и лампа включается на макс убавляешь хоть до 1в горит как только вольтметр показывает 0 лампа опять запускается только на макси


Что за транс не понятно.
Ты хоть размер «сердечника» или диаметр провода вторичной обмотки замирил тогда бы что-то было ясно.
При 3А в нагрузке, сколько выдаёт переменки?


при нагрузке 3а на выходе бп выдает 21в переменки. с транса выходит несколько выходов 12в 25 и двух полярный выход


при нагрузке 3а на выходе бп выдает 21в переменки. с транса выходит несколько выходов 12в 25 и двух полярный выход
Вопрос: почему у транса без нагрузки 25В, а при нагрузки 3А 21В?
Думаю сам ответишь и тебе всё понятно станет.


извиняюсь. я в этом деле новичок. чет до меня не доходит в чем причина?


С напряжением разобрался стабилитроны не правильно подключил. А вот лампа не загорается если ее подключить до включения самого блока питания че за фигня?


проблемма только с запуском выдает 32в постоянки 4 А тянет галагенку Н4 на 60/55W.


извиняюсь. я в этом деле новичок. чет до меня не доходит в чем причина?
Для начала тебе совет: каждую деталь перед установкой нужно проверять тестером.
А по завершению, прежде чем включить ещё раз всё сверяешь со схемой.
Обычно после этого проблем не возникает.
Замерь на С1 должно 30В, а на стабилитроне Д814Д 12В.


все так и есть на с1 30в стабилитроне 12в


А без нагрузки он регулирует напряжение?


Кстати, вместо связки КТ817 и КТ819 можно использовать один составной транзистор КТ827 (http://www.chipinfo.ru/dsheets/transistors/1827.html).


без нагрузки напряжение регулирует. и в нагрузки регулирует но только от максимума ниже и такие лампы как н4 запускаются плохо. думаю выходной кондер надо емкостью по больше воткнуть


как достану кт827 попробую поставит. 819А у меня сечас и 805 стоят. А если 827 ставить нужно будет R4 убрать? или ставить его между базой и коллектором?


А если 827 ставить нужно будет R4 убрать? или ставить его между базой и коллектором?
Если применять 827, то R3 и R4 из схемы вообще исключаются. Нужные смещения напряжений уже заданы в самом 827. По сути, в данном случае, он представляет из себя элементы R3, T1, T2 и R4 в одном корпусе. 🙂


круто надо поискать:)


Всем привет!!! Народ подскажите пожалуйста не произойдет ли изменей в роботе схемы, если вместо R5 и R6 поставить 360/2w и стабилитрон д814г и обязательно ставить Т2 на радиатор?????


Всем привет!!! Народ подскажите пожалуйста не произойдет ли изменей в роботе схемы, если вместо R5 и R6 поставить 360/2w и стабилитрон д814г и обязательно ставить Т2 на радиатор?????
R5 и R6 Разница не на настольклько значительна — можно. (делитель напряжения)
Если в цепи коллектора стоит сопр. 2Вт, то радиатор для транзистора явно нужен.
PS: (R5 и R6) Просто в холостом режиме увеличится незначительное потребление тока а при «уходе д814д от изначального 12В может измениться диапазон регулировки».


Ясно. Спасибо за ответ.Осталось ток развести печатку и спаять)))


Решил собрать себе сие чудо техники (без иронии), возник вопрос:
С напряжением разобрался стабилитроны не правильно подключил….
Так как подключены стабилитроны? Параллельно, последовательно, или «валетом»(один в ону сторону, другой в обратную)?


Да, и хотелось-бы сделать какую нибудь защиту от КЗ (ну не менять-же выходной предохранитель каждый раз. Случаи всякие бывают, что — мешочек с предохранителями привязывать?) Буду признателен.
Результаты деятельности выложу.
Спасибо.


Спасибо, добрые люди.


Да, и хотелось-бы сделать какую нибудь защиту от КЗ (ну не менять-же выходной предохранитель каждый раз. Случаи всякие бывают, что — мешочек с предохранителями привязывать?) Буду признателен.
Результаты деятельности выложу.
Спасибо.
Оказывается транзистор Т3 + 2диода и резисторы R5 и R6 выполняют роль защиты от КЗ.


Решил собрать себе сие чудо техники (без иронии), возник вопрос:

Так как подключены стабилитроны? Параллельно, последовательно, или «валетом»(один в ону сторону, другой в обратную)?

Думал, думал и поставил один Д815Д.


Вообщем,поставил в схему КТ827, Стабилитрон Д815Д и пределы на холостом ходу = 4 — 20 Вольт.
Большего добиться не могу. Что-то в обвязке основного транзистора надо поменять, а что?…
Проделал много опытов, но результата, хотя бы = 0 — 25 Вольт , не получаю.
Наверно буду собирать другую схему, применив часть этих деталей.

Видимо тема всем надоела.Всем привет…


Hobbi TV

30.10.2012, 13:47

Видимо тема всем надоела.
Сейчас перспективней делать БП на мк с управлением через Wi-Fi с компьютера. Такой БП мы сейчас и разрабатываем…


Я собрал, но по другой схеме.



Hobbi TV

31.10.2012, 23:46

Держи плюс за упорство! *DRINK*


a.garbuz

04.11.2012, 18:38

R4 я тож мощный поставил греется при подключении лампы h5. но не горит норм. ток меж лампой и блоком на максе 3А. транс с кокого то кинотеатра довольно большой. переменки выдает 25 вольт. максим. ток обмоток не знаю. и еще если убавить ток регулятором до нуля то запускается транс примерна на 5 в. т.е когда с 0 прибавляешь 0показывает примерно до тех пор пока не станет 5в. и лампа включается на макс убавляешь хоть до 1в горит как только вольтметр показывает 0 лампа опять запускается только на макси
заменил транзистор Т3 (КТ361) — на германиевый типа МП25А все скачки исчезли!!! (подсказали на другом форуме)

Добавлено через 2 минуты
Оказывается транзистор Т3 + 2диода и резисторы R5 и R6 выполняют роль защиты от КЗ.
У меня при КЗ амперметр (10 А) зашкаливает а вольтметр падает на «0» это нормально?


да это норма!! напруга падает а ток растёт !! поставь в цепь варистр чтоб он отключал ток ато чтонить перегорит!


a.garbuz

04.11.2012, 20:12

да это норма!! напруга падает а ток растёт !! поставь в цепь варистр чтоб он отключал ток ато чтонить перегорит!
Спасибо за ответ! Подробней можно? какой варистр? и куда в цепь?:[

Добавлено через 4 минуты
Получается в этой схеме нет защиты от «КЗ»?


варистр http://ru.wikipedia.org/wiki/%D0%92%D0%B0%D1%80%D0%B8%D1%81%D1%82%D0%BE%D1%80 http://go.mail.ru/search_images?q=%D0%B2%D0%B0%D1%80%D0%B8%D1%81%D1%82%D0%BE%D1%80&rch=l&fr=web#w=640&h=480&s=88760&pic=http%3A%2F%2Fel-shema.ru%2FFOTO2%2Fvaristory.jpg&page=http%3A%2F%2Fel-shema.ru%2Fpubl%2Fpitanie%2Ffiltr_pitanija%2F5-1-0-37&descr=%D0%B2%D0%B0%D1%80%D0%B8%D1%81%D1%82%D0%BE%D1%80%20(%D0%BD%D0%B5%D0%BB%D0%B8%D0%BD%D0%B5%D0%B9 %D0%BD%D0%BE%D0%B5%20%D1%81%D0%BE%D0%BF%D1%80%D0%BE%D1%82%D0%B8%D0%B2%D0%BB%D0%B5%D0%BD%D0%B8%D0%B5)

поставь в цепь значит перед выходом на клемму!! у него очень интерестное своество, при кз его сопротевление увеличивается и отключает питание до тех пор пока не отключиш нагрузку только исчи на своё напряжение и ток!!


Какие напряжения должны бить на транзисторах в http://savepic.net/575686.gif
http://savepic.ru/3304339.gif
С ув.Сергей


a.garbuz

23.11.2012, 20:19

Я не шарю в этом!Знаю только закон ома!)))


Я искал и вот нашол
http://radiokot.ru/circuit/power/supply/25/


а это тем кому лень!!!!!

http://www.dessy.ru/catalog-pdc368391.html
http://www.dessy.ru/catalog-pdc368393.html
http://www.dessy.ru/catalog-pdc368392.html


Собрал такой биполярник на макетной. Работает. А печатную для него случайно никто не разработал???


Mavlyudov

20.07.2013, 21:32

Вот печатка. Вроде правильно.


Lebowski_dk

09.09.2013, 01:49

KEDR_7 Поделитесь своей печаткой.


СириуС

17.11.2013, 05:35

Приветствую всех!
Схема блока питания- отличная! Все работает без проблем!
Собираю уже четыре раза и все норм.
Но есть некоторые нюансы-
1- Вместо КТ361 я ставлю МП40 или подобные. Схема работает стабильнее.
2- Была та же хунта: Убавляем напругу плавно до минимума, а как начинаем прибавлять- ничего. И потом внезапно как даст сразу вольт пять и выше регулируется. Потом снова, плавно до 0, а как прибавлять- ничего до определенного момента. А потом хлоп- и 5В и выше регулируется. И если, например, поставить напругу на почти минимум и выключить БП, то включив его, нужно снова будет крутить ручку до макс. и потом уже убавлять до нужного значения.
Проблема имеет решение. Я собирал по этой схеме блоки питания на разные напряжения- 0-8В, 0-12В, 0-20В. Приходится, естественно, подбирать стабилитрон под верхний порог рег. напряжения и ..внимание..резистор R2 (5,6к). Ибо если мы убавили до 0 и начинаем прибавлять, то слабый ток течет через R2 и нифига не открывает Т2, который должен открыть Т1. Как поддаем достаточно на базу Т3 , ток возрастает и способен уже открыть Т2, который, в свою очередь, открывает Т1. Вот когда поодаем достаточно и Т1 открывается, мы и получаем сразу опа-5В(примерно). Ибо до этого ток шел через R2, а теперь его достаточно, чтоб отпереть Т2.
Незнаю, насколько грамотно то, что я тут написал (если что, буду признателен, если поправите), НО при замене резюка 5,6к на резистор с бОльшим сопротивлением, проблема, описанная выше, была решена. И при выключении-включении не нужно снова крутить регулировку на мксимум, а потом выставлять напругу.
3- Можно увеличить мощность блока, применив транзистор в металле или набрав несколько транзюков 819 в парралель. Не забываем ставить уравнивающие резисторы на 0,33 Ом после эмиттера каждого тразистора, ибо у транзюков есть разброс параметров и если не поставить эти резюки, один будет вкалывать больше другого, а это неправильно. Мы же хотим равноправия?
Вот такие пироги. Завтра выложу фото печатной платы. У меня она компактно вышла.


Lebowski_dk

17.11.2013, 15:45

Вместо КТ361 я ставлю МП40 или подобные. Схема работает стабильнее. А защита работает после замены на германиевый?
2- Была та же хунта: Убавляем напругу плавно до минимума, а как начинаем прибавлять- ничего
Тоже проблама такая же,под нагрузкой уменьшаешь напряжение до минимума,а потом начинаешь увеличивать и на выходе ноль! отключаешь нагрузку потом опять подключаеш и всё норм регулируется.
НО при замене резюка 5,6к на резистор с бОльшим сопротивлением, проблема, описанная выше, была решена. Какой номинал ставили?


СириуС

19.11.2013, 03:57

Здравствуйте.
Итак, по порядку:
1- После замены на германиевый МП40, коих у меня есть, в отличие от Кт-шек, защита спокойно держит КЗ на 8В в течении трех секунд. Дольше не проверял, ибо не хочется попалить 819. Думаю, трех сек. защиты полюбому хватит.
2- На какое макс. напряжение Вы собираете БП? Вот я сейчас вожусь с этой схемой, адаптируя её на 2-8В, а Вы? Также, есть один аспект- на выходе нужно минимум 2200мФ\1 ампер. Я эту схему без электролитов на выходе запускал, с одним 2200 по входу. Под нагрузкой дурковала, но стоило поставить емкость- приходило в норму.
Я сейчас валю спать, ибо провозился с ним полночи, НО я нашел кое-какую интересную взаимосвязь, которая Вас заинтересует. Завтра ..эм..точнее уже сегодня расскажу и покажу фото.
3- Насчет номинала резистора- тоже чуть позже. Но все же мне удалось отладить схему под 8 стабилизированных вольт, чему я очень рад.
*DRINK*
ПС- Вас нет на Урбантрипе?


Несколько странная схема. 🙂 Собирайте лучше на ОУ, стабильнее будет. 🙂


Lebowski_dk

20.11.2013, 00:58

Помню я ставил вместо кт361 германиевый так при КЗ трансформатор гудел и транзистор VT1 грелся,а с кт361 всё норм!при КЗ ничё не гудит не греется. БП у меня будет до 30V. Конденсаторы у меня 2200мкф.и на входе и на выходе,трансформатор 40Вт. нагружал на галогенку 12V 40Вт.


Константин1

20.11.2013, 16:18

а что за транс использовал


40Вт, мало до ужаса.


Lebowski_dk

20.11.2013, 19:37

Несколько странная схема. Собирайте лучше на ОУ, стабильнее будетКиньте парочку ссылок.
40Вт, мало до ужаса. дело не в трансформаторе,надо попробывать R2 увеличить.


Lebowski_dk

08.12.2013, 18:01

СириуС ну где там ПП?
Увеличивал R2 не помогло… Под нагрузкой уменьшая на минимум уходит в защиту,помогло лишь добавление резистора на 560Ом к ножке которая идёт на + переменному резистору.Регулируется от 1.5 Вольт но зато под нагрузкой в защиту не уходит,но при запуске БП под нагрузкой ноль на выходе,отключаешь нагрузку потом опять подключаешь и всё норм.


Всем привет вот собрал данный блок питания вроде схема несложная но возникли вопросы . трансформатор у меня тн 61 на выходе в холостом ходу переменки даёт 27 вольт воп
щем собрал я схему вместо советского стабилитрона я поставил импортный 1w на 27 вольт вольтметр у меня на 30 вольт так вот когда я его включаю без емкости с 1 он даёт 26 вольт а когда присоеденяю ёмкость то прибавляется 10 вольт вопщем напряжение получается больше чем 27 вольт на выходе я пока не ставил ёмкость все детали проверял несколько раз . может кто подскажет в чём дело почему стабилитрон не держит хотя должно было быть на выходе 27 вольт ёмкость у меня на 2000 мкф как сделать чтоб на выходе было 27 вольт как на стабилитроне. Я так понял что у этого блока питания другая то есть нестандартная стабилизация и нужно поставить стабилитрон не на 27 а на 15 вольт и за сщёт ёмкости она подымется и будет на выходе 25 вольт где то так вопщём окончательно запутался


Lebowski_dk

27.01.2014, 17:38

когда присоеденяю ёмкость то прибавляется 10 вольт
Так и должно быть,после диодного моста и конденсатора,напряжение увеличивается в 1,41 раз.
почему стабилитрон не держит
Увелич сопротивление резистора,которое стоит последовательно стабилитрону.


Увеличить резистор после стабилитрона и что это даст ? вопщем я поставил стабилитрон д815е на 15 вольт ёмкост с1 пока неподключал в холостом ходу выдаёт 20,5 вольт вместо нагрузки я использовал лампу на 24 вольта ток у неё 1А потом напряжение просело до 15 вольт подсоеденил ёмкость стало ровно 25 вольт опять нагрузку просадки нету непонятно както просто остаток напряжения находиться на ёмкости. вопщем если я поставлю стабилитрон на 20 вольт то на выходе будет 30 вольт прост непонятно почему я поставил стабилитрон на 15 вольт а он выдовал 20,5 вольт а на нагрузке просело до 15 может и за ёмкости которая паралельна стабилитрону помом я понял что схема работает


Здравствуйте, подскажите пожалуйста как лучше подключить к денной схеме кулер на 12 вольт(хочу собрать схему с вентилятором), если к стабилитрону, то не зашунтирует ли он его и какой переменный резистор тогда использовать.


Здравствуйте, подскажите пожалуйста как лучше подключить к денной схеме кулер на 12 вольт(хочу собрать схему с вентилятором), если к стабилитрону, то не зашунтирует ли он его и какой переменный резистор тогда использовать.
Извините, но данный вопрос порождает ответный: Вы точно знаете, что делаете ?


Как в схеме работает защита?


Здравствуйте, подскажите пожалуйста зачем два стабилитрона и как их включить последовательно (для увеличения нпапряжения) или паралельно(увеличивая ток).*SCRATCH*


Здравствуйте, подскажите пожалуйста зачем два стабилитрона и как их включить последовательно (для увеличения нпапряжения) или паралельно(увеличивая ток).*SCRATCH*

два стабилитрона параллельно ток они не увеличат а мощность да я вопще поставил импортный 1w а стабилитрон как включить последовательно ну это проще если вы знаете как подключить последовательно два резистора то это тоже самое только на одном конце должен быть плюс это анод и минус катод я так и поставил один стабилитрон на 10v а другой на 6.2v я просто подгонял чтоб на выходе было 30v да меня кстати тоже удевило зачем в схеме два паралельных стабилитрона иза тока наврятли а иза увеличение мощности возможно


Здравствуйте, подскажите пожалуйста как лучше подключить к денной схеме кулер на 12 вольт(хочу собрать схему с вентилятором), если к стабилитрону, то не зашунтирует ли он его и какой переменный резистор тогда использовать.

я извеняюсь а он там нужен ли вопще этот кулер поставте радиатор побольше вы что на нём постоянно 5А держать будете ну а если уж так и нужно то соберите точно такуюже цепочку из резистора и стабилитрона вот ток кулера я незнаю думаю что 1w стабилитрон подайдёт и всё и никто никаво шунтировать небудет ну а если вы хотите чтоб ваш кулер крутился не постоянно а с увеличением температуры радиатора то в нете полно схем их используют для усилителей мощности чтобы неспалить микросхемы или транзисторы


Сеогей

16.06.2015, 20:33

Всем привет, собрал блок питания по этой схеме, возникла проблема: на выходе 23 В.
На д814д напряжение 12 В, на С1 напряжение 44 В, переменное напряжение с трансформатора 30 В.


vBulletin® v3.8.7, Copyright ©2000-2022, vBulletin Solutions, Inc. Перевод: zCarot

1.7.2. О деталях. Электронные самоделки

Читайте также

1.2.2. О деталях

1.2.2. О деталях Постоянные резисторы R1, R2 — типа МЛТ-0,25. Оксидный конденсатор С2 выполняет роль фильтра по питанию — сглаживает пульсации напряжения. Конденсатор С1 должен быть обязательно на рабочее напряжение не ниже 300 В, марки К76-3 или аналогичный, неполярный и

1.3.3. О деталях

1.3.3. О деталях Резистор R1 марки МЛТ-2, резистор R2 — типа МЛТ-0,5. Аккумулятор и лампы нагрузки подключаются к устройству многожильными изолированными сетевыми проводами сечением не менее 1 мм и с минимальной длиной (для уменьшения потерь энергии в проводах). Конденсатор С1

2.8.2. О деталях

2.8.2. О деталях Все постоянные резисторы типа МЛТ-0,25. Конденсатор С2 типа КМ-6, группы ТКЕ H70 или аналогичный. Пьезоэлектрический капсюль ВМ1 можно заменить на ЗП-1, ЗП-18, ЗП-22 или другой аналогичный. Для этой цели хорошо подходит пьезоэлектрический капсюль из электронных часов

3.1.2. О деталях

3.1.2. О деталях Микросхему DD1 в этой схеме можно заменить на К176ИЕ18, но тогда выводы 4 и 7 нужно будет разомкнуть, вывод 14 соединить с общим проводом, а сигнал для моргания точки снимать с вывода 4 микросхемы.Напряжение питания этой схемы не должно превышать 5 В, большее

3.3.3. О деталях

3.3.3. О деталях Постоянные резисторы R1, R2 типа МЛТ-0,25. Пьезоэлектрический капсюль может быть любым, рассчитанным на напряжение 4…20 В постоянного тока, например, FMQ-2015D, FXP1212, KPI-4332-12.Транзистор VT1 любой кремниевый, малой и средней мощности структуры n-p-n, например, КТ603, кТ608, КТ605,

3.4.1. О деталях

3.4.1. О деталях Все постоянные резисторы типа МЛТ-0,25 или аналогичные.Вместо диодов VD1, VD2 можно установить КД503, КД509, КД521 с любым буквенным индексом. Эти диоды защищают светодиод в режиме перегрузки (гасят излишнее напряжение).К сожалению, на практике нет возможности

3.5.1. О деталях

3.5.1. О деталях Самым дорогим элементом в предлагаемой конструкции является микросхема DA1. Ее можно заменить близким по электрическим характеристикам ОУ TL072 или TL082. У них идентичное расположение выводов. Вторым по значимости в устройстве является пассивный электретный

3.7.3. О деталях

3.7.3. О деталях Кажущаяся сложность в изготовлении датчика и катушки L1 не более чем миф. Практика испытаний устройства показала, что даже при удалении феррита от каркаса L1 на расстоянии до 5 мм датчик уверенно срабатывает от сотрясения и качения феррита вблизи катушки. Это

4.12.2. О деталях

4.12.2. О деталях Устройство комплектуется аккумуляторами Ni-Cd типа АА с номинальным напряжением 1,2 В и емкостью 700 мА/ч.Транзисторы VT1—VT3 можно заменить отечественными приборами типа КТ312, КТ343 с любым буквенным индексом или аналогичные.И тип аккумуляторов, и их емкость, на

5.3.2. О деталях

5.3.2. О деталях Кроме указанного на схеме трансформатора подойдут также ТН30-220-400, ТН32-220-400, ТН36-220-400, ТН60-220-400. В этих случаях изменяется только мощность трансформатора (соответственно 30, 32, 36 или 60 Вт) без изменения схемы. А для трансформаторов типа ТН47-220-400, ТН48-220-400

2.3.1. О деталях

2.3.1. О деталях В последнее время в розничной продаже появились соединители USB с встроенным светодиодом– подсветкой в прозрачном корпусе. В таком случае, нахождение контактов для подключения дополнительного оборудования является наиболее простой задачей.Транзисторный

2.5.3. О деталях

2.5.3. О деталях В усилителе применены малогабаритные импортные резисторы с мощностью рассеяния 0,05 Вт. Можно использовать и резисторы для поверхностного монтажа, к примеру, типоразмера 0805. Оксидные конденсаторы – К50-35 или сходные по электрическим характеристиками и току

3.3.2. О деталях

3.3.2. О деталях Устройство комплектуется Ni-Cd аккумуляторами типа АА с номинальным напряжением 1,2 В и емкостью 700 мА/ч.Транзисторы VT1—VT3 можно заменить на отечественные приборы типа КТ312, КТ343 с любым буквенным индексом и

3.17.2. О деталях

3.17.2. О деталях Кроме указанных на схеме, в качестве HL1—HL3 рекомендую использовать мощные светодиоды HPWS-TH00 или аналогичные с током потребления до 80 мА. Можно применять только один светодиод из серий LXHL-DL-01, LXHL-FL1C, LXYL-PL-01, LXHL-ML1D, LXHL-PH01, LXHL-Mh2D производства Lumileds Lighting (все –

Транзистор кт819гм содержание драгметаллов — Мастерок

На чтение 1 мин Просмотров 13 Опубликовано

Транзисторы КТ819 , 2Т819 и КТ818 , 2Т818 широко применяются в радиоаппаратуре в качестве ключевых элементов или выходных транзисторов в звуковоспроизводящих устройствах. Транзисторы достаточно дешевы и имеют сравнительно неплохие параметры что способствовало их широкому распространению в странах СНГ.

В статье представлены основные параметры и характеристики (даташиты) транзисторов КТ819 , 2Т819 и КТ818 , 2Т818. Для каждого транзистора представлена цоколевка при выполнении в пластмассовом и металлическом корпусе.

КТ819 , 2Т819 – кремниевый транзистор структуры n-p-n.

Рис. 1. Изображение транзистора КТ819 на принципиальных схемах.

Рис. 2. КТ819 (А. Г), 2Т819 (А2. В2) в пластиковом корпусе, внешний вид и цоколевка.

Рис. 3. КТ819 (АМ. ГМ), 2Т819 (А. В) в металлическом корпусе, внешний вид и цоколевка.

Основные технические характеристики транзисторов КТ819:

Предельные параметрыRТ п-к, °C/Вт
IК, max, АIК и, max, АUКЭ0 гр, ВUКБ0 max, ВUЭБ0 max, ВPК max, ВтTК, °CTп max, °CTК max, °Ch21ЭUКЭ
(UКБ),
В
IК (IЭ), АUКЭ нас, ВIКБ0, мАfгр, МГцКш, дБCК, пФCЭ, пФtвкл, мксtвыкл, мкс
КТ819А1015255602512510015(5)521310002,51,67
КТ819Б1015405602512510020(5)521310002,51,67
КТ819В1015605602512510015(5)521310002,51,67
КТ819Г1015805602512510012(5)521310002,51,67
КТ819АМ152025510025125100155521310002,51
КТ819БМ152040510025125100205521310002,51
КТ819ВМ152060510025125100155521310002,51
КТ819ГМ152080510025125100125521310002,51
2Т819А15208010051002515012520(5)51310002,51,25
2Т819Б1520608051002515012520(5)51310002,51,25
2Т819В1520406051002515012520(5)51310002,51,25
2Т819А21520801005402515010020(5)(5)1370020001,23,13
2Т819Б2152060805402515010020(5)(5)1370020001,23,13
2Т819В2152040605402515010020(5)(5)1370020001,23,13

КТ818 , 2Т818 – кремниевый транзистор структуры p-n-p

Рис. 4. Изображение транзистора КТ818 на принципиальных схемах.

Рис. 5. КТ818(А. Г), 2Т818(А-2. В-2) в пластиковом корпусе, внешний вид и цоколевка.

Рис. 6. КТ818(АМ. ГМ), 2Т818(А. В) в металлическом корпусе, внешний вид и цоколевка.

Основные технические характеристики транзисторов КТ818:

Справочная информация по перечню и количеству содержания драгоценных металлов в изделии: Транзистор КТ819ГМ.

Данные взяты из открытых источников: документации к изделию, формуляров, технической литературы, нормативной документации.

Приводится точная масса содержания драгметаллов: золота, серебра, платины и металлов платиновой группы (МПГ) на единицу изделия в граммах.

Примечание : по справочнику: “Содержание драгоценных металлов в электротехнических изделиях, аппаратуре связи, контрольно-измерительных приборах, кабельной продукции, электронной и бытовой технике. Информационный справочник в шести частях. Часть 1. Изделия и элементы общепромышленного назначения. – 2-е изд., перераб. и доп. -М.: ООО “Связьоценка”, 2003″

Для удобства в таблице отсутствуют некоторые параметры. Развёрнутый список параметров каждого транзистора показан на странице с его описанием. Не стоит, также, забывать, что транзисторы 2Т8ххх являются аналогами транзисторов КТ8ххх, а отличаются тем, что имеют более жёсткую приёмку, однако параметры для обоих типов транзисторов аналогичны.

“>

Практические схемы усилителей мощности на кт 805. Транзисторный усилитель мощности. Бестрансформаторный транзисторный усилитель мощности

Всем, кто затрудняется выбрать первую схему для сборки, хочу порекомендовать этот усилитель с 1 транзистором. Схема очень проста, и может быть выполнена как монтажным, так и печатным монтажом.

Сразу скажу, что сборка данного усилителя оправдана только в качестве эксперимента, так как качество звука будет в лучшем случае на уровне дешевых китайских ресиверов — сканеров.Если кто-то хочет собрать себе маломощный усилитель с более качественным звучанием, используя микросхему TDA 2822m, то может перейти по ссылке:


Портативная колонка для плеера или телефона на микросхеме tda2822m
Контрольное фото усилителя:


На следующем рисунке приведен список необходимых деталей:

Практически любой изn — p — n структуры, например КТ 817. На входе желательно поставить пленочный конденсатор емкостью 0,22 — 1 МкФ. Пример пленочных конденсаторов на следующем фото:

Привожу чертеж печатной платы из программы Sprint-Layout:


Сигнал берется с выхода мп3 плеера или телефона, земля и один из используются каналы. На следующем рисунке показана схема подключения штекера Jack 3.5 для подключения к источнику сигнала:


При желании этот усилитель, как и любой другой, можно оснастить регулятором громкости, подключив потенциометр на 50 кОм согласно к стандартной схеме используется 1 канал:


Параллельно с блоком питания, если в блоке питания после диодного моста нет электролитического конденсатора большой емкости, необходимо подать электролит на 1000 — 2200 МкФ, с рабочее напряжение больше, чем напряжение питания схемы.
Пример такого конденсатора:

Скачать печатную плату однотранзисторного усилителя для программы sprint — layout можно в разделе Мои файлы сайта.

Оценить качество звука этого усилителя вы можете посмотрев видео его работы на нашем канале.

Алексей, а почему бы не начать задавать вопросы более осознанно? Тогда можно будет ответить точнее. Это не я потому что вот я такой гуру весь в белом, а он там «сапикано» презренный, я его мордой по столу тащу — нет, конечно.Но либо «…состав можно использовать или нет для увеличения мощности…», либо «…мощности достаточно…» — тут одно, согласитесь. И если бы вас интересовало, почему греются выходные транзисторы, то сразу спросили бы об этом.
И снова по порядку. «Проблема в другом выходе» — как это понимать? Выход усилителя — два провода, сигнальный и общий, они у вас в изложении и греются?
Ок, речь все же идет о чрезмерном, на ваш взгляд, нагреве выходных транзисторов.У вас они «греются все 4 транзистора на радиаторе» — попробую отфильтровать этот поток. Прогреваются — значит «прогреваются», в определенных пределах эти транзисторы должны прогреваться. Греются по сигналу на большой мощности или без сигнала греются? До какой температуры греются — если приблизительно, то страдает палец (это градусов 50-60) или можно чайник на радиаторе кипятить?
Не указано.
«все 4 транзистора на радиаторе от магнитолы комета» — и что? Алексей, самых разных моделей магнитофонов «Комета» с 50-х годов и до конца советских времен было выпущено чуть больше фига, это опять ни о чем.Каковы размеры радиатора и какова измеренная номинальная мощность усилителя при какой нагрузке?
Не указано.
«может радиатор маловат» — а хрен его знает, может маловат. Или, может быть, в самый раз. Или, может быть, ток покоя слишком велик. Какой ток покоя? Каково это при включении, то есть на холодном усилителе и каково после работы усилителя без сигнала в течение 20-30 минут? Почему было выбрано именно такое значение этого тока, а не больше или меньше?
Не указано.
«на выходе кт 819» — опять: и что? КТ819 в пластике или КТ819 в металле — не уточняется — у этих разновидностей разные площади контакта с радиатором, пластиковые при прочих равных немного больше греются, ничего страшного.
Видишь ли, Алексей, ты так ставишь вопросы, что при всем желании вряд ли можно ответить на твою ситуацию. Поэтому некоторые причины перегрева выходных транзисторов довольно абстрактны:

Это так, вспомнил на ходу.Может еще кто чего вспомнит. А ставить параллельно два выходных транзистора при такой выходной мощности смысла нет: при нормальной нагрузке и в нормальном режиме одиночные потянут без проблем. КТ819 точно потянет.
По уважительной причине нужно не придумывать, что еще прикрутить, а измерить режимы транзисторов и посмотреть осциллографом, что происходит в схеме как без сигнала, так и при работе от генераторов синуса и импульсов; что имеем на холостом ходу, а что под нагрузкой или при ее эквиваленте.Такой разговор будет предметным, а пока все напоминает попытку описать сегодняшнюю погоду по ощущениям на выставленном в окно слюнявом пальце.
И первый шаг – уметь правильно сформулировать задачу: что наблюдается, что не устраивает, к чему стремимся и какие затраты по пути будут считаться приемлемыми.
И тогда, Алексей, тебе помогут эффективнее.

Высокое входное сопротивление и неглубокая обратная связь являются ключом к теплому ламповому звучанию.Не секрет, что самые качественные и дорогие усилители, относящиеся к категории HI-End, реализуются на лампах. Давайте разберемся, что такое качественный усилитель? Усилитель мощности низкой частоты, полностью повторяющий на выходе форму входного сигнала, не искажая его, разумеется, выходной сигнал уже усилен. В сети можно найти несколько схем действительно качественных усилителей, которые имеют право принадлежать к категории HI-End и ламповая схема вовсе не обязательна.Для получения максимального качества нужен усилитель, выходной каскад которого работает в чистом классе А. Максимальная линейность схемы дает минимальное количество искажений на выходе, поэтому в конструкции качественных усилителей особое внимание уделяется этот фактор. Схемы ламп хороши, но не всегда доступны даже для самостоятельной сборки, а промышленные лампы УМЗЧ от брендовых производителей стоят от нескольких тысяч до нескольких десятков тысяч долларов США — эта цена наверняка многим не по карману.
Возникает вопрос — можно ли добиться подобных результатов от транзисторных схем? ответ будет в конце статьи.

Линейных и сверхлинейных схем усилителей мощности низкой частоты очень много, но схема, которая сегодня будет рассмотрена, является качественной ультралинейной схемой, которая реализована всего на 4-х транзисторах. Схема была создана еще в 1969 году британским звукорежиссером Джоном Линсли-Худом. Автор является создателем еще нескольких качественных схем, в частности класса А.Некоторые специалисты называют этот усилитель самым качественным среди транзисторных УНЧ, и я убедился в этом еще год назад.

Первая версия такого усилителя была представлена ​​на . Удачная попытка реализации схемы заставила меня создать двухканальный УНЧ по той же схеме, собрать все в корпус и использовать для личных нужд.

Особенности схемы

Несмотря на свою простоту, схема имеет ряд особенностей. Корректная работа может быть нарушена из-за неправильной компоновки платы, неправильного размещения компонентов, неправильного источника питания и т. д.
Именно мощность является особо важным фактором — категорически не советую питать данный усилитель от всяких блоков питания, лучший вариант — аккумулятор или блок питания с параллельно подключенной батареей.
Мощность усилителя 10 Вт при питании 16 вольт на нагрузке 4 Ом. Сама схема может быть адаптирована для головок на 4, 8 и 16 Ом.
Я создал стерео вариант усилителя, оба канала расположены на одной плате.

Второй предназначен для раскачки выходного каскада, поставил КТ801 (достать было довольно сложно.
В самом выходном каскаде поставил мощные двухполюсные ключи обратной проводимости — КТ803 с ними получил несомненно высокое качество звука, хотя экспериментировал со многими транзисторами — КТ805, 819, 808, даже ставил мощные составные — КТ827, с ним мощность намного выше, но звук не сравнится с КТ803, хотя это только мое субъективное мнение.

Входной конденсатор емкостью 0,1-0,33 мкФ, нужно использовать пленочные конденсаторы с минимальной утечкой, желательно известных производителей, то же самое и с выходным электролитическим конденсатором.
Если схема рассчитана на нагрузку 4 Ом, то не следует повышать напряжение питания выше 16-18 вольт.
Регулятор звука решил не ставить, он в свою очередь тоже влияет на звук, но резистор 47к желательно поставить параллельно входу и минусу.
Сама плата является макетной. С платой пришлось долго возиться, так как линии дорожек тоже влияли на качество звука в целом. Этот усилитель имеет очень широкую частотную характеристику, от 30 Гц до 1 МГц.

Настройка очень проста. Для этого нужно добиться на выходе переменным резистором половины напряжения питания. Для более точной настройки стоит использовать многооборотный переменный резистор. Подключаем один щуп мультиметра к минусу питания, другой ставим на выходную линию, то есть к плюсу электролита на выходе, таким образом, медленно вращая переменник, добиваемся половинной мощности на выходе.

Они ушли в прошлое, и теперь, чтобы собрать любой простой усилитель, больше не нужно мучиться с расчетами и клепать большую печатную плату.

В настоящее время практически вся дешевая усилительная аппаратура выполнена на микросхемах. Наибольшее распространение получили микросхемы TDA для усиления звукового сигнала. В настоящее время они используются в автомагнитолах, активных сабвуферах, домашних колонках и многих других усилителях звука и выглядят примерно так:



Плюсы микросхем TDA

  1. Для того чтобы собрать на них усилитель, достаточно подать питание, подключить динамики и несколько радиоэлементов.
  2. Размеры этих микросхем очень маленькие, но ставить их придется на радиатор, иначе они будут сильно греться.
  3. Продаются в любом радиомагазине. На Али что-то дороговато, если брать в розницу.
  4. Имеют встроенные различные защиты и другие опции, такие как отключение звука и так далее. Но по моим наблюдениям защиты работают не очень хорошо, поэтому микросхемы часто умирают либо от перегрева, либо от . Так что желательно не замыкать выводы микросхемы между собой и не перегревать микросхему, выжимая из нее все соки.
  5. Цена.Я бы не сказал, что они очень дорогие. По цене и выполняемым функциям им нет равных.

Одноканальный усилитель на TDA7396

Соберем простой одноканальный усилитель на микросхеме TDA7396. На момент написания статьи я взял его по цене 240 рублей. В даташите на микросхему сказано, что эта микросхема может выдавать до 45 Вт на нагрузку 2 Ома. То есть если измерить сопротивление катушки динамика и оно будет около 2 Ом, то на динамике вполне можно получить пиковую мощность 45 Вт.Этой мощности вполне достаточно, чтобы устроить в комнате дискотеку не только для себя, но и для соседей и при этом получить посредственный звук, который, конечно, не идет ни в какое сравнение с hi-fi усилителями.

Вот распиновка микросхемы:


Собирать наш усилитель будем по типовой схеме, которая была приложена в самом даташите:


+Vs подаем на ногу 8, а не подавайте что угодно на ногу 4. Следовательно, схема будет выглядеть так:


Vs — напряжение питания.Оно может быть от 8 до 18 вольт. «IN+» и «IN-» — сюда подаем слабый звуковой сигнал. Цепляем динамик к 5-й и 7-й ножке. Ставим шестую ногу на минус.

Вот мое настенное крепление в сборе


Конденсаторы по питанию 100нФ и 1000мкФ не использовал, так как у меня чистое напряжение от блока питания.

Качал динамик со следующими параметрами:


Как видите сопротивление катушки 4 Ома.Полоса частот указывает на то, что это тип сабвуфера.

А вот так выглядит мой саб в самодельном корпусе:


Пробовал снимать видео, но звук на видео очень плохой для меня. Но все же могу сказать, что от телефона на средней мощности уже гудело так, что уши заворачивались, хотя потребление всей схемы в рабочем виде было всего около 10 ватт (умножить 14,3 на 0,73). В данном примере я взял напряжение как в автомобиле, то есть 14.4 Вольта, что вполне укладывается в наш рабочий диапазон от 8 до 18 Вольт.


Если у вас нет мощного блока питания, то можно собрать его по этой схеме.

Не зацикливайтесь на этой конкретной микросхеме. Типов этих микросхем TDA, как я уже говорил, существует множество. Некоторые из них усиливают стереосигнал и могут выводить звук сразу на 4 динамика, как это сделано в автомагнитолах. Так что не поленитесь порыться в интернете и найти подходящий TDD.Завершив сборку, дайте соседям проверить ваш усилитель, открутив на всю балалайку ручку громкости и прислонив мощный динамик к стене).

А вот в статье я собрал усилитель на микросхеме TDA2030A

Получилось очень хорошо, так как TDA2030A имеет лучшие характеристики, чем TDA7396

Для разнообразия так же приложу еще одну схему от абонента, у которого усилитель на ТДА 1557Q работает исправно уже более 10 лет подряд:


Усилители на Алиэкспресс

На али еще нашел китовые комплекты на ТДА.Например, вот этот стереоусилитель на 15 Вт на канал за 1 доллар. Этой мощности вполне достаточно, чтобы потусоваться с любимыми треками в маленькой комнате.


Можно купить.

А здесь уже готово сразу


И вообще этих модулей усилителя на Алиэкспресс очень много. Нажмите на эту ссылку и выберите любой понравившийся вам усилитель.

Хотим обратить ваше внимание на еще один усилитель мощности.Несмотря на относительно небольшую выходную мощность, он имеет ряд неоспоримых преимуществ. Во-первых, он прямо как валенок и полностью доступен для повторения. Во-вторых, в нем нет дефицитных и дорогих комплектующих, поэтому его можно собрать даже там, где затруднен доступ к радиодеталям или есть дырка в кармане.

Характеристики усилителя следующие:

Основные характеристики:

Схема:

Схема очень проста, и если вы решили посвятить себя сборке разрозненных усилителей и исследованию их деятельности, то имеет смысл начать именно с этого усилителя.Схема очень стабильная и не капризная.

Детали:

Обозначение на схеме Наименование
С1 20mkFx16V
С2 20мкФх25В
С3 1000
С4 50мкФх25В
С5 20мкФх50В
С6 0.1 мкФ
Р1 10к
Р2 1,5к
Р3 5,6к
Р5 5,6к
Р5 1,5к
Р6 10к
R7 от 1 до
Р8 150
Р9 3,9к
R10 от 1 до
R11 2.2к
R12 510
R13 150
Р14 510
R15 100
R16 100
Р17 0,2
Р18 0,2
R19 12
ВТ1 КТ315В
ВТ2 КТ315В
VT3 КТ203А
ВТ4 КТ315В
ВТ5 КТ601АМ
ВТ6 КТ203А
ВТ7 КТ815Б
ВТ8 КТ815Б
ВТ9 КТ805А
ВТ10 КТ805А
Транзисторы VT1 и VT2 должны быть согласованы по коэффициенту усиления.Чтобы облегчить себе жизнь, можно взять готовую транзисторную сборку. Резисторы R17, R18 можно сделать из проволоки.

Персонализация

Настройка усилителя сводится к настройке тока покоя транзистора VT9. В разрыв токосъемного провода включают миллиамперметр и регулировкой резистора R11 устанавливают ток 50-70 мА. Затем проверяется отсутствие постоянного напряжения на выходе усилителя с точностью до 0,1В.

Все.Закончил упражнение.

Все настройки выполняются при отключенной нагрузке.

И не забудьте плотно присоединить транзистор VT4 к радиатору транзистора VT9. От этого зависит термостабильность усилителя. Можно, например, приклеить термоклеем или запрессовать фланец транзистора VT9. Скачать печатную плату в формате LAY ( Прислал: Шамрин Роман )

Опосредованная малой РНК петля отрицательной обратной связи контролирует динамику восприятия кворума у ​​Vibrio harveyi

Abstract

Биолюминесцентная морская бактерия Vibrio harveyi использует для координации процесс межклеточной коммуникации, называемый определением кворума (QS). поведения в ответ на изменение плотности населения.QS достигается за счет секреции и обнаружения внеклеточных сигнальных молекул, называемых аутоиндукторами. В центре схемы V. harveyi QS находятся пять малых регуляторных РНК, называемых Qrr1–5, которые дестабилизируют мРНК luxR , кодирующего LuxR, основного регулятора транскрипции генов-мишеней QS. Здесь мы показываем, что LuxR напрямую активирует транскрипцию qrr 2, qrr 3 и qrr 4, что приводит к быстрому подавлению luxR .LuxR-связывающие сайты в промоторах qrr 2, qrr 3 и qrr 4 были идентифицированы и мутированы, чтобы определить влияние этой регуляторной петли на динамику QS. Нарушение цикла задерживает переход от высокой плотности ячеек к низкой и, что более важно, снижает плотность ячеек, при которой популяция достигает кворума. Наши результаты показывают, что обратная связь необходима для оптимизации динамики переходов между индивидуальным и групповым поведением.

Введение

Бактерии реагируют на колебания окружающей среды, связывая внешнюю сенсорную информацию с соответствующими изменениями поведения. Регуляторные сети, которые настраивают бактерии на окружающую среду, обычно передают информацию факторам транскрипции, которые контролируют определенные наборы генов в ответ на определенные раздражители. Регуляторные сети строятся из повторяющихся единиц, называемых сетевыми мотивами, которые выполняют определенные этапы обработки информации (Hartwell et al ., 1999; Алон, 2007). Часто дополнительные функции, накладываемые на эти биологические сети, точно контролируют динамику сенсорного реле и повышают его надежность. Например, петли положительной обратной связи могут способствовать быстрому переходу между отдельными стабильными состояниями, в то время как петли отрицательной обратной связи могут ускорять время отклика и уменьшать межклеточные вариации (Ferrell, 2002; Rosenfeld et al. ., 2002). Интеграция сенсорной информации необходима для адаптации бактерий; таким образом, экологическая ниша организма, вероятно, стимулирует эволюцию оптимизированных сетевых архитектур.

Одним из изменяющихся параметров окружающей среды, отслеживаемых бактериями, является плотность клеточной популяции, и это достигается с помощью определения кворума (QS). QS представляет собой механизм химической коммуникации, который позволяет бактериям отслеживать плотность популяции путем секреции и обнаружения внеклеточных сигнальных молекул, называемых аутоиндукторами (AI) (Waters and Bassler, 2005). QS-бактерии контролируют концентрацию AI как показатель количества клеток. В ответ на накопление AI бактериальные популяции скоординировано изменяют экспрессию больших наборов генов для выполнения задач, которые предположительно продуктивны только тогда, когда группы клеток действуют согласованно.

У биолюминесцентной морской бактерии Vibrio harveyi QS контролирует такие процессы, как биолюминесценция, секреция типа III, производство и метаболизм циклического ди-ГМФ (Fuqua et al. ., 1994; Miller and Bassler, 2001; Henke and Bassler). , 2004; Waters and Bassler, 2006; Waters et al ., 2008) (подробности см.). V. harveyi синтезирует три ИИ. HAI-1, N -(β-гидроксибутирил)гомосеринлактон, который является самым сильным из трех сигналов, представляет собой видоспецифичный AI, продуцируемый синтазой LuxM (Cao and Meighen, 1989; Bassler et al ., 1993). CAI-1 ( S )-3-гидрокситридекан-4-он представляет собой специфический для рода сигнал, который продуцируется CqsA-синтазой (Miller et al. ., 2002; Higgins et al. ., 2007). Третий AI, AI-2 (2 S ,4 S )-2-метил-2,3,3,4-тетрагидрокситетрагидрофуранборат, представляет собой межвидовой сигнал, продуцируемый синтазой LuxS (Bassler et al ., 1997; Schauder и др. ., 2001; Chen и др. ., 2002). Каждый из трех ИИ обнаруживается родственным мембранным двухкомпонентным гистидинкиназным сенсором: HAI-1 связывается с LuxN (Bassler et al ., 1993; Freeman et al. ., 2000), CAI-1 связывается с CqsS (Miller et al. ., 2002), а AI-2 распознается LuxQ в сочетании с периплазматическим белком LuxP (Bassler et al. ., 1994; Neiditch и др. ., 2005; 2006).

Модель V. harveyi Цепь определения кворума. V. harveyi продуцирует и обнаруживает три AI и посредством модуляции уровней основного регулятора транскрипции LuxR контролирует нижестоящие гены-мишени QS.Три AI: CAI-1 (кружки), который связывается с CqsS, HAI-1 (пятиугольники), который связывается с LuxN, и AI-2 (двойные пятиугольники), который связывается с LuxPQ. При LCD, когда LuxO фосфорилируется (LuxO~P), он активирует транскрипцию генов, кодирующих пять Qrr sRNAs, которые работают в сочетании с Hfq, дестабилизируя мРНК luxR . При HCD, когда LuxO не фосфорилирован, транскрипция qrr прекращается, мРНК luxR стабилизируется и продуцируется белок LuxR. В петле обратной связи LuxR активирует экспрессию qrr 2, qrr 3 и qrr 4, что влияет на время переходов QS.ОМ, наружная мембрана; ИМ, внутренняя мембрана.

При незначительных концентрациях ИИ, то есть при низкой плотности клеток (LCD), три сенсора действуют как киназы, которые переносят фосфат через LuxU в LuxO (Freeman and Bassler, 1999a,b; Lilley and Bassler, 2000). LuxO˜P активирует экспрессию генов, кодирующих пять высококонсервативных малых регуляторных РНК (sRNAs), называемых Qrr1-5 (Tu and Bassler, 2007). Qrrs соединяются с 5′-UTR мРНК luxR и дестабилизируют ее, для этого процесса требуется РНК-шаперон Hfq (Lenz et al ., 2004). LuxR является основным регулятором транскрипции генов QS у V. harveyi (Showalter et al. ., 1990; Swartzman et al. ., 1992). Таким образом, при ЖКД при малом количестве LuxR QS отсутствует и клетки V. harveyi выступают как особи. При высокой плотности клеток (HCD) AI накапливаются и связываются со своими родственными сенсорами. Это событие заставляет сенсоры действовать как фосфатазы, что приводит к дефосфорилированию LuxO. Нефосфорилированный LuxO неактивен. Транскрипция генов, кодирующих sRNA, прекращается, вызывая накопление luxR мРНК (Freeman and Bassler, 1999b; Lilley and Bassler, 2000).Новообразованный белок LuxR активирует и репрессирует многочисленные гены. В частности, LuxR активирует оперон luxCDABE , кодирующий люциферазу, которая необходима для биолюминесценции (Miyamoto et al. , 1994). Таким образом, при HCD инициируется QS, и клетки V. harveyi действуют как группа.

Большинство регулирующих компонентов схемы QS были определены в V. harveyi , что позволяет нам приступить к анализу особенностей сети QS-сигнализации, оптимизирующих V.harveyi способна реагировать на различные условия сообщества. Здесь мы сообщаем об открытии петли отрицательной обратной связи в регуляторном каскаде V. harveyi QS с участием LuxR и Qrr мРНК. Мы показываем, что LuxR напрямую связывается и активирует транскрипцию промоторов, предшествующих qrr 2, qrr 3 и qrr 4, но не qrr 1 или qrr 5. мРНК и снижение продукции LuxR.Мутация консенсусных сайтов связывания LuxR в промоторах V. harveyi qrr 2, qrr 3 и qrr 4 нарушает петлю отрицательной обратной связи и влияет на время перехода из режима HCD в режим LCD и наоборот. У близкородственного вида Vibrio cholerae мы ранее охарактеризовали петлю отрицательной обратной связи, состоящую из HapR (гомолог LuxR) и мРНК V. cholerae Qrr (Svenningsen et al. ., 2008). Однако в году В.cholerae , механизм обратной связи HapR для активации экспрессии qrr отличается от механизма V. harveyi . В совокупности наши исследования предполагают, что отрицательная обратная связь, опосредованная LuxR/HapR-sRNA, важна для оптимизации динамики переходов между индивидуальным и групповым поведением у вибрионов .

Результаты

LuxR связывается с промоторами

qrr2 , qrr3 и qrr4

HapR, V.cholerae , гомолог V. harveyi LuxR, активирует экспрессию генов V. cholerae qrr через непрямой механизм (т. е. HapR не связывает промоторы qrr напрямую). Опосредованная HapR-sRNA петля обратной связи работает только во время перехода от HCD к LCD, когда присутствуют как HapR, так и LuxO˜P, и при этом она ускоряет переход V. cholerae из социального режима в индивидуальный. сотовый режим (Свеннингсен и др. ., 2008). Поскольку нам неизвестна идентичность компонента, связывающего HapR с генами qrr , мы смогли изучить поведение QS только у штаммов V. cholerae , которые являются HapR + или HapR , но не у штаммы, которые представляют собой HapR + с устраненной петлей отрицательной обратной связи. V. cholerae и V. harveyi тесно связаны и имеют похожие, но не идентичные цепи QS, поэтому мы задались вопросом, имеет ли V. harveyi аналогичную петлю обратной связи, в которой LuxR активирует V.harveyi qrr ген. Если это так, мы предположили, что можем использовать различия между схемами QS V. harveyi и V. cholerae , чтобы лучше понять роль этой петли обратной связи.

Чтобы проверить различия между петлями обратной связи V. harveyi и V. cholerae , мы провели анализ сдвига подвижности геля с очищенным белком LuxR и расположенными выше промоторными областями qrr 1–5, чтобы установить, может ли LuxR связываться им.LuxR напрямую связывается с промоторами qrr 2, qrr 3 и qrr 4, но не с промоторами qrr 1 или qrr 5 (). Изучение паттернов связывания позволяет предположить, что in vitro , LuxR имеет наибольшую аффинность к промотору qrr 4, за ним следует qrr 2 и затем qrr 3. В соответствии с этими результатами консенсусный сайт связывания LuxR , TATTGATAAATTTATCAATAA (Pompeani et al. ., 2008), присутствует в промоторах qrr 2, qrr 3 и qrr 4, но отсутствует в промоторах qrr 904 64 1 и 64 64 1 и qrr 5.Мы изменили консенсусный сайт связывания в qrr 2, qrr 3 и qrr 4, рандомизировав область при сохранении исходного содержания A/T и G/C, которое мы назвали qrr 2 luxR-bs , qrr 3 luxR-bs и qrr 4 luxR-bs , и это устранило привязку LuxR ().

LuxR и HapR связываются с промоторами V. harveyi qrr 2, qrr 3 и qrr 4

A. Анализ изменения подвижности геля при связывании LuxR с V.harveyi qrr промоторы WT и мутированные промоторы qrr 2, qrr 3 и qrr 4 (обозначенные как qrr luxR-bs ), лишенные сайта связывания LuxR. Использовали зонд 10 нм со следующими концентрациями очищенного белка LuxR (нМ) (слева направо): 0, 6,25, 31,25, 62,5, 125. B. Промоторные области показаны для пяти генов V. harveyi qrr . Консенсусные сайты связывания LuxR (крайние левые черные прямоугольники) в qrr 2, qrr 3 и qrr 4 изображены относительно сайтов связывания LuxO (крайние правые черные прямоугольники).C. Сдвиги подвижности геля при связывании HapR с промоторами V. harveyi qrr WT и мутированными промоторами V. harveyi qrr 2, qrr 3 и qrr 4 (обозначены как qrr 4 4) отсутствует сайт связывания LuxR. Использовали зонд 10 нм со следующими концентрациями очищенного белка HapR (нМ) (слева направо): 0, 25, 125, 250 500.

LuxR и HapR принадлежат к семейству регуляторов транскрипции TetR, которые имеют сходную ДНК. -связывание сайтов узнавания.Важно отметить, что вышеуказанный консенсусный сайт связывания отсутствует у всех промоторов V. cholerae qrr , что согласуется с нашими более ранними выводами о том, что у V. cholerae регуляция HapR транскрипции qrr является косвенной. Мы задались вопросом, может ли HapR, будучи неспособным связываться с промоторами V. cholerae qrr , может связываться с промоторами V. harveyi qrr 2, qrr 3 и qrr 4, поскольку LuxR и HapR имеют 88% идентичности последовательностей. в ДНК-связывающем домене и 70% идентичности последовательности в общей последовательности белка.Анализ сдвига в геле () показывает, что, как и V. harveyi LuxR, HapR связывает промоторы qrr 2, qrr 3 и qrr 4 с наивысшей аффинностью к qrr 4, 6 qrr 2,4 9063. и HapR проявляет слабое сродство к qrr 3 (+). Для наблюдения связывания требовались более высокие концентрации белка HapR, чем белка LuxR. Однако HapR не сдвигал промоторы qrr 2, qrr 3 и qrr 4, когда сайт связывания LuxR-консенсус был мутирован, показывая, что белок HapR специфически связывается с сайтом связывания LuxR.

Luxr достаточно для активации транскрипции

QRR2 , QRR3 и QRR4 и QRR4 и QRR4 в Escherichia Coli

Luxo~p абсолютно требуется для RUD Expression Expression (Lenz et al ., 2004). Учитывая результаты, мы задались вопросом, ответственны ли только LuxR и LuxO˜P за транскрипционный контроль генов qrr или в их регуляции участвуют другие факторы. Чтобы исследовать это, мы ввели конститутивно активный мутантный аллель luxO , который имитирует LuxO˜P, на хромосому E.coli на сайте λ att . Мы также ввели в этот штамм две плазмиды: одна плазмида содержит luxR под своим нативным промотором, а вторая плазмида содержит gfp -транскрипционное слияние с каждым из промоторов V. harveyi qrr . Для каждого слияния qrr-gfp мы вводили конструкции, несущие либо LuxR-консенсус-связывающий сайт дикого типа (WT), либо мутированный сайт. показывает, что в присутствии LuxO˜P транскрипция qrr 2, qrr 3 и qrr 4 активируется LuxR в E.coli , тогда как qrr 1 и qrr 5 не показывают повышения экспрессии в присутствии LuxR. Опять же, эти результаты подтверждаются биоинформатикой и анализами сдвига подвижности геля в . В случае слияний qrr-gfp , несущих мутированные LuxR-связывающие сайты, LuxR-зависимая активация экспрессии снижается для qrr 2 ( qrr 2 luxR-bs ) и устраняется для qrr 3 и qrr 4 ( qrr 3 luxR-bs и qrr 4 luxR-bs ).Анализы сдвига геля предполагают, что LuxR не может связываться с мутантным промотором qrr 2 in vitro ; однако эксперимент предполагает, что, по-видимому, остается умеренный эффект LuxR in vivo . Это может быть связано с различиями в архитектуре in vitro и in vivo промотора qrr 2 , который позволяет LuxR связывать in vivo . Вместе эти данные указывают на то, что в присутствии LuxO˜P LuxR напрямую активирует экспрессию qrr 2, qrr 3 и qrr 4, и требуется предсказанный сайт связывания LuxR.Эти результаты резко контрастируют с нашими результатами с V. cholerae , где HapR регулирует экспрессию qrr только посредством дополнительного неизвестного фактора, и не происходит активации экспрессии qrr в E. coli , несущих HapR и LuxO~. P (Svenningsen и др. ., 2008).

LuxR напрямую активирует транскрипцию qrr 2, qrr 3 и qrr 4 в E. coli . Конститутивно активный аллель luxO , luxO D47E, был рекомбинирован на хромосому E.coli штамм MC4100 в сайте λ att . Проточную цитометрию использовали для измерения продукции флуоресценции (в условных единицах) от слияний WT V. harveyi qrr gfp и промоторов qrr с мутированными сайтами связывания LuxR ( qrr luxR-bs ). . Измерения проводились в присутствии и в отсутствие LuxR. E.coli штаммов: KT1646 ( RUR 1- GFP ), KT1648 ( QRR 1- GFP + LUXR ), KT1529 ( QRR 2- GFP ), KT1530 ( QRR 2- GFP + kt1535 ( QRR 2 RUSR-BS GFP ), KT1536 ( QRR 2 Luxr-BS GFP + Luxr ) , KT1531 ( QRR 3- GFP ), KT1532 ( QRR 3- GFP + LUXR + LUXR ), KT1614 ( QRR 3 Luxr-BS GFP ), KT1615 ( QRR 3 LUXR-BS GFP + LuxR ), KT1533 ( QRR 4- GFP ), KT1534 ( QRR 4- GFP + Luxr ), KT1539 ( QRR 4 luxR-bs gfp ), KT1540 ( qrr 4 luxR-bs gfp + luxR ), KT1647 ( 9 3 5 6 qrr 4 qrr 4 qrr 0464), КТ1649 ( qrr 5- gfp + люксR ).Фоновую флуоресценцию измеряли в отсутствие LuxO˜P, которая в среднем составляла около 20 единиц (данные не показаны). Культуры выращивали в трех экземплярах, и планки погрешностей обозначают стандартное отклонение среднего значения.

Удаление

Luxr и сайты, связывающие на , QRR2 , QRR3 и QRR4 и QRR4 Уменьшите экспрессию QRR в V. Harveyi

Вышеуказанные результаты устанавливают прямую связь между Luxr и QRR 2 , qrr 3 и qrr 4 выражение.Чтобы определить, как в E. coli , LuxR активирует экспрессию qrr в V. harveyi , мы измерили уровни Qrr на LCD и HCD с использованием количественной ПЦР в реальном времени у WT V. harveyi , a Δ luxR и штамм, в котором три сайта связывания LuxR в промоторах qrr были мутированы ( qrr 2,3,4 luxR-bs ). Наши результаты показаны в . Каждый транскрипт Qrr нормализуется к соответствующему уровню в WT на LCD.Во-первых, по сравнению с WT V. harveyi при LCD уровни Qrr резко снижаются у WT V. harveyi при HCD (черные полосы). Этот результат согласуется с нашей моделью, в которой гена qrr максимально экспрессируются при LCD, когда LuxO˜P в изобилии, и минимально экспрессируются при HCD, когда LuxO не фосфорилирован [(Lenz et al ., 2004; Tu and Басслер, 2007)]. Во-вторых, при LCD уровни Qrr2, Qrr3 и Qrr4 значительно снижены у штаммов Δ luxR и qrr 2,3,4 luxR-bs по сравнению с WT (белые столбцы и серые столбцы соответственно).В-третьих, при HCD уровни Qrr3 и Qrr4 в этих мутантных штаммах снижаются еще больше. Эти последние два результата подтверждают, что LuxR активирует экспрессию qrr 2, qrr 3 и qrr 4 in vivo , потому что в отсутствие LuxR или в штамме V. harveyi , в котором LuxR -сайты связывания удалены из промоторов qrr , экспрессия qrr снижается. Мы отмечаем, что это также подтверждает, что qrr 1, хотя и контролируется плотностью клеток, не активируется LuxR in vivo , и, кроме того, что qrr 5 не подвергается контролю плотности клеток или регуляции обратной связи LuxR-Qrr, поскольку Qrr5 уровни примерно одинаковы во всех исследованных штаммах.Этот последний пункт согласуется с нашими предыдущими исследованиями, демонстрирующими, что QS не контролирует экспрессию qrr 5 (Tu and Bassler, 2007).

LuxR активирует выражение qrr 2, qrr 3 и qrr 4 в V. harveyi . РНК выделяли из BB120 (WT; черные столбцы), KM669 (Δ luxR ; белые столбцы) и KT551 ( qrr 2,3,4 luxR-bs ; серые столбцы) на LCD (OD 600 ˜ 0,025) и ГЦД (OD 600 -1,5).Уровни Qrr измеряли с помощью количественной ПЦР в реальном времени. Измерения были нормализованы к значениям WT на ЖК-дисплее, и на графике нанесены кратные различия. Каждый образец был проанализирован в четырех экземплярах, а планки погрешностей обозначают стандартное отклонение среднего значения.

Петля обратной связи LuxR-sRNA ускоряет переход от HCD к LCD. .harveyi

и сравнили их с таковыми у штамма V. harveyi , лишенного петли обратной связи. В этом последнем штамме мы мутировали сайты связывания LuxR в промоторах qrr 2, qrr 3 и qrr 4 ( qrr 2,3,4 luxR-bs ), чтобы отключить петлю обратной связи. . Мы также сравнили уровни Qrr4 у этих двух штаммов на фоне Δ luxR . Кроме того, во всех штаммах мы удалили luxM и luxS , кодирующие синтазы AI, и использовали добавление очищенных AI для точного контроля состояний HCD и LCD.Все штаммы выращивали в присутствии насыщающих ИА, а затем культуры промывали и ресуспендировали в свежей среде без ИА, чтобы имитировать немедленный переход от HCD к LCD. показан Нозерн-блот-анализ уровней мРНК Qrr4 и luxR в течение периода, непосредственно следующего за промывкой в ​​среде, не содержащей AI. На верхней панели показано, что у штаммов WT и qrr 2,3,4 luxR-bs уровни Qrr4 быстро увеличиваются после перехода от HCD к LCD; однако штамм WT обладает большим количеством Qrr4, чем штамм, лишенный петли обратной связи LuxR-sRNA во все моменты времени (сравните дорожки 1-5 с 6-10).Количественное определение интенсивности сигнала транскрипта Qrr4 показывает, что сразу после перехода от HCD к LCD Qrr4 накапливается в WT в два раза быстрее, чем в штамме, лишенном петли обратной связи LuxR-sRNA. Примерно через 10 минут в свежей среде уровни Qrr4 в штамме, лишенном петли обратной связи, действительно накапливаются почти до уровней WT. Средняя панель показывает, что после удаления AI транскрипт luxR расщепляется быстрее в штамме WT, чем в штамме, лишенном петли обратной связи.В частности, время полужизни мРНК luxR составляет ~2 мин в штамме WT и ~4 мин в штамме без петли обратной связи. Вместе эти результаты показывают, что инактивация петли обратной связи LuxR-sRNA задерживает, но не отменяет переход V. harveyi из социального режима в режим индивидуальной клетки. Дорожки 11–20 на верхней панели показывают, что уровни Qrr4 дополнительно снижаются в обоих тестовых штаммах, когда им не хватает luxR . Этот результат предполагает, что дополнительные факторы могут функционировать через LuxR, чтобы регулировать экспрессию qrr в V.Харви .

Петля обратной связи LuxR-sRNA влияет на переход HCD в LCD. V. Harveyi штаммы KT794 (Δ Luxm , δ Luxs ), KT797 (Δ Luxm , δ Luxs , QRR 2,3,4 Luxr-BS ), KT827 (δ Luxm , δ Luxs , Luxr , Luxr :: Kan) и KT829 (Δ Luxm , δ Luxs , QRR 2,3,4 Luxr-BS , Luxr :: Kan) были выращен до OD 600 −1.5 в присутствии насыщающих AI (по 5 мкМ HAI-1 и AI-2 каждого), а затем промывали и ресуспендировали в свежей среде для имитации перехода от HCD к LCD. РНК выделяли в указанное время после промывки и мРНК Qrr4 и luxR анализировали с помощью Нозерн-анализа. РНК 5S показана в качестве контроля загрузки, и интенсивности полос для люкс мРНК были количественно определены и нормализованы к РНК 5S. Эксперимент проводился дважды.

Петля обратной связи LuxR-sRNA действует при переходе от LCD к HCD

показывает, что в отсутствие петли обратной связи LuxR-sRNA уровни Qrr2, Qrr3 и Qrr4 снижены при HCD относительно WT.Учитывая, что sRNAs Qrr максимально продуцируются при ЖКД, мы задались вопросом, может ли снижение уровней Qrr при HCD способствовать увеличению продукции LuxR, что, в свою очередь, может повлиять на время экспрессии гена-мишени HCD. Чтобы проверить это, мы сконструировали штаммы, которые являются WT по петле обратной связи, которые содержат одну мутацию qrr luxR-bs , так что петля обратной связи функционирует на двух генах qrr , но не на третьем (их три). Мутаты: QRR 2 LUXR-BS и QRR и QRR и RUSR-BS и QRR и QRR 4 Luxr-BS ), а также Triple QRR 2,3,4 Luxr-BS Mutant в котором обратная связь полностью исключена.Мы также сконструировали мутации в этих штаммах, чтобы они реагировали исключительно на экзогенно поставляемые AI, путем удаления luxM и luxS . Мы также удалили ген cqsS , чтобы исключить ответ на CAI-1. Используя биолюминесценцию в качестве показателя, мы измерили реакцию каждого штамма на увеличение концентрации ИИ (1). Полумаксимальная эффективная концентрация AI для WT V. harveyi составляет 19 нМ. Single QRR RUSR Мутанты BS Restants на несколько более низких уровней AI ( QRR 2 luxr-bs = 13 нм, qrr 3 luxr-bs = 16 нм и qrr 4 luxr -bs = 13 нМ).Тройной мутант qrr 2,3,4 luxR-bs реагирует на значительно более низкий AI, 4 нМ, демонстрируя, что штамм, лишенный петли обратной связи LuxR-sRNA, в пять раз более чувствителен к AI, чем WT. Следовательно, обратная связь LuxR-sRNA действительно контролирует переход LCD в HCD, предотвращая преждевременный переход V. harveyi в состояние HCD и неправильную экспрессию генов, необходимых для социального поведения. Важно отметить, что все штаммы, использованные в эксперименте, относятся к AI и, таким образом, не производят LuxR до тех пор, пока не будет добавлен экзогенный AI.Это показывает, что петля отрицательной обратной связи LuxR-sRNA влияет на белок LuxR, который синтезируется в ответ на ИИ.

Петля обратной связи LuxR-sRNA влияет на переход LCD в HCD. Следующие штаммы были протестированы на их реакцию на различные концентрации ИИ с использованием световой продукции в качестве показателя: TL27 (Δ люкс M , Δ люкс S , Δ cqsS ; черные квадраты), KT773 (TL27, qrr 2 luxR-bs ; синие ромбы), KT770 (TL27, qrr 3 luxR-bs ; зеленые треугольники), KT767 (TL27, qrr 4 luxR-bs ; фиолетовые треугольники), KT819 (4067, фиолетовые треугольники) qrr 2,3,4 luxR-bs ; красные кружки).Данные были сопоставлены с сигмоидальной кривой доза-реакция с переменным наклоном, чтобы определить концентрацию полумаксимального ответа для каждого штамма. RLU – это отсчет мин.

Нарушение петли обратной связи LuxR-Qrr влияет на динамику восприятия кворума

Одним из важнейших аспектов настоящего исследования, который отличает его от более раннего исследования V. cholerae , является то, что мы можем вырезать петлю обратной связи, опосредованную LuxR-sRNA, и исследовать последствия поведения QS ниже по течению.Для этого мы сконструировали штамма V. harveyi , в которых только один сайт связывания LuxR предшествует либо qrr 2, qrr 3, либо qrr 4 ( qrr 2 luxR-2, qrr 3 luxR-bs или qrr 4 luxR-bs ) был мутирован. Мы создали двойной мутант qrr 2,4 luxR-bs и тройной мутантный штамм, в котором три сайта связывания LuxR были удалены ( qrr 2,3,4 luxR-bs ).Эта стратегия позволила нам частично или полностью устранить петлю отрицательной обратной связи, сохранив остальную часть цепи QS нетронутой. Мы измеряли биолюминесценцию как результат поведения QS.

У WT V. harveyi экспрессия биолюминесценции демонстрирует характерный QS-регулируемый паттерн (открытые квадраты): после ночного разбавления культуры HCD производство света на клетку резко снижается. Это снижение биолюминесценции связано с разбавлением ИИ ниже уровня, необходимого для активации экспрессии люкс .Однако по мере роста культуры эндогенно продуцируемые ИИ увеличиваются до тех пор, пока не будет достигнут критический порог ИИ, и снова начинается производство света. Когда только один из трех LuxR-связывающих сайтов в генах qrr мутирован, V. harveyi демонстрирует несколько более высокую светопродукцию, чем WT, при переходе от LCD к HCD, с qrr 4 luxR-bs . мутант, демонстрирующий наибольшее увеличение светоотдачи (закрашенные кружки), за ним следует мутант qrr 2 luxR-bs (закрашенные ромбы) и, наконец, мутант qrr 3 luxR-bs (закрашенные треугольники) .Кроме того, переход происходит раньше у мутантов, чем у штамма WT, что указывает на то, что мутантные штаммы реагируют на более низкие концентрации AI. Этот паттерн аналогичен паттерну аффинности LuxR-связывания с каждым промотором qrr (10). У двойного qrr 2,4 luxR-bs мутанта V. harveyi наблюдается большее усиление биолюминесценции и более ранний переход, чем у любого из одиночных qrr luxR-bs мутантов (, заштрихованные квадраты ).Наконец, при полном отсутствии петли отрицательной обратной связи LuxR-sRNA (тройной мутант qrr 2,3,4 luxR-bs ) мы наблюдаем наиболее драматичный эффект, так как штамм показывает примерно 10-кратное увеличение биолюминесценция и наиболее ранний переход из LCD в режим QS (светлые кружки). Т.о., переход к HCD происходит с возрастающей скоростью у мутантов, которые все более дефектны в работе петли обратной связи LuxR-sRNA.

Петля обратной связи LuxR-sRNA влияет на динамику QSharveyi штаммы: BB120 (WT, открытые квадраты), KT383 ( qrr 2 luxR-bs ; закрытые ромбы), KT613 ( qrr 3 luxR-bs ; закрытые треугольники), KT383 (64 q0464 qrr-bs ; закрытые треугольники) luxR-bs ; темные кружки), КТ523 ( qrr 2,4 luxR-bs ; темные квадраты), KT551 ( qrr 2,3,4 luxR-bs ; светлые кружки). RLU – это отсчет мин.

Чтобы понять вклад отдельных LuxR-Qrr-опосредованных петель обратной связи в переход QS, мы сконструировали V.harveyi , несущие одну конкретную инактивирующую мутацию промотора qrr luxR-bs в штамме, несущем только этот конкретный интактный qrr . Наше обоснование состояло в том, чтобы изучить, как функционирует петля обратной связи в присутствии нескольких или только одной Qrr sRNA (18). Для сравнения мы показываем поведение WT V. harveyi (т.е. присутствуют все мРНК Qrr). У дикого типа максимальная Qrr-опосредованная репрессия экспрессии биолюминесценции происходит на LCD (светлые квадраты на всех панелях).У штамма qrr 2 + , в котором присутствует только qrr 2, клетки продуцируют от 10 до 100 раз больше света, чем WT на всех стадиях роста (закрашенные ромбы), а мутируя Сайт связывания LuxR ( qrr 2 + luxR-bs ) вызывает дополнительное ~10-кратное увеличение биолюминесценции (открытые ромбы). Та же тенденция сохраняется для qrr 3 (сравните незамкнутые и незакрашенные треугольники) и qrr 4 (, сравните закрашенные и незаштрихованные кружки). Поэтому, когда в V.harveyi QS цепь, петля обратной связи LuxR-Qrr играет более важную роль, чем когда присутствуют все мРНК Qrr, предполагая, что наличие нескольких Qrrs буферирует цепь QS от возмущений, и это предотвращает преждевременное проникновение V. harveyi в HCD , состояние QS.

Множественные мРНК защищают цепь QS от возмущений. Петля обратной связи LuxR-sRNA была нарушена в штаммах V. harveyi , содержащих только один ген qrr , и была измерена биолюминесценция, зависящая от плотности.Были протестированы WT BB120 (светлые квадраты на всех панелях) и следующие штаммы V. harveyi : A. KT280 ( qrr 2 + , закрытые ромбы), KT381 ( qrr 2 +luxR-bs, открытые ромбы). Б. КТ300 ( qrr 3 + , незамкнутые треугольники), КТ548 ( qrr 3 +luxR-bs , незамкнутые треугольники). C. KT281 ( qrr 4 + , темные кружки), KT353 ( qrr 4 +luxR-bs , незаштрихованные кружки). RLU – это отсчет мин.

Обсуждение

Бактерии преодолевают трудности выживания в изменяющейся среде, отслеживая в своей среде колебания различных параметров, и в ответ на изменения этих внешних параметров вносят соответствующие изменения в экспрессию генов. QS позволяет морской бактерии V. harveyi отслеживать и реагировать на изменения плотности клеточной популяции и видового состава окружающего микробного сообщества. Здесь мы сообщаем о наличии петли отрицательной обратной связи в ядре V.harveyi QS, в которой LuxR, основной регулятор транскрипции генов, контролируемых QS, напрямую активирует экспрессию мРНК Qrr, что приводит к дестабилизации мРНК luxR . Петля обратной связи LuxR-sRNA влияет на скорость опосредованных QS изменений во время обоих переходов QS: от HCD к LCD и от LCD к HCD. Т.о., петля обратной связи LuxR-sRNA способствует правильному выбору времени программ экспрессии генов, которые лежат в основе как индивидуального, так и коллективного поведения.

Ранее мы сообщали о наличии петли обратной связи HapR-sRNA в цепи QS V. cholerae , которая, хотя и непрямая, тем не менее ускоряет переход бактерий из режима HCD в режим отдельных клеток (Svenningsen et al . , 2008). Поскольку фактор, связывающий HapR с регуляцией генов qrr , остается неизвестным у V. cholerae , мы не смогли разъединить петлю обратной связи и изучить последствия поведения QS ниже по течению.К счастью, у V. harveyi , поскольку взаимодействие обратной связи LuxR-Qrr является прямым, и были идентифицированы сайты связывания ДНК LuxR (Pompeani et al ., 2008), мы смогли отключить петлю обратной связи и измерить ее эффекты. .

При переходе от HCD к LCD потеря петли обратной связи LuxR-sRNA предотвращает повышение уровней Qrr до их максимальных уровней. Следовательно, деградация мРНК luxR замедляется, что приводит к задержке экспрессии генов, необходимых для индивидуального клеточного поведения.Таким образом, у WT V. harveyi, роль петли обратной связи LuxR-sRNA при переходе от HCD к LCD заключается в ускорении выхода из группового режима и входа в индивидуальный клеточный режим. При переходе LCD к HCD нарушение петли обратной связи LuxR-sRNA делает V. harveyi значительно более чувствительным к ИИ, чем WT V. harveyi . Таким образом, мутанты, у которых отсутствует петля обратной связи, экспрессируют гены, необходимые для группового поведения при более низких концентрациях AI. Это открытие подразумевает, что у WT при переходе от LCD к HCD роль петли обратной связи LuxR-sRNA заключается в активации экспрессии qrr , разрушении мРНК luxR и контроле плотности клеток, при которой популяция выходит из индивидуального сотовый режим и вход в групповой режим.

Отметим, что при переходе от LCD к HCD обратная связь работает в условиях жесткого ограничения LuxR. Это означает, что LuxR должен обладать высокой аффинностью к промоторам qrr . Соответственно, наши биоинформатические анализы показывают, что сайты связывания LuxR на промоторах qrr больше напоминают сайты связывания LuxR-консенсуса, чем сайты связывания LuxR на других известных генах, регулируемых LuxR (Pompeani et al ., 2008). . В совокупности эти исследования предполагают, что при наличии LuxR сначала связывается с генами qrr , чтобы инициировать петлю обратной связи и отсрочить переход в QS-режим.Только позже, после накопления дополнительного белка LuxR, LuxR связывается с нижестоящими генами-мишенями и регулирует их.

Vibrio harveyi и V. cholerae имеют немного разные петли обратной связи LuxR/HapR-sRNA. LuxR напрямую активирует экспрессию генов qrr V. harveyi, тогда как HapR не может активировать генов qrr V. cholerae. Кроме того, петля обратной связи в V. harveyi управляет переходом от LCD к HCD, чего нет в V.холера . Мы обнаружили, что у штамма V. harveyi Δ luxR задержка экспрессии qrr более резкая, чем задержка у штамма qrr 2,3,4 luxR-bs сразу после Переход от HCD к LCD (). Мы интерпретируем это как означающее, что фактор, отличный от LuxR, действует на гены qrr во время этого перехода. Эти результаты предполагают возможность того, что неизвестный компонент, который связывает HapR с генами V. cholerae qrr , может также функционировать в V.Харви . Интересно, что ближайшим известным родственником V. harveyi является человеческий патоген Vibrio parahaemolyticus , и выравнивание последовательностей промоторов V. harveyi и V. parahaemolyticus qrr 2, qrr 3 и 4rr964 qrs показывает, что все три сайта связывания LuxR по существу консервативны. Мы предполагаем, что первоначально петли обратной связи LuxR/HapR/OpaR [ V. parahaemolyticus (McCarter, 1998)] были непрямыми, и это остается в случае V.холера . Прямая регуляция по принципу обратной связи LuxR/OpaR генов qrr развилась совсем недавно у V. harveyi и V. parahaemolyticus и, вероятно, обеспечивает некоторое преимущество для ниш, в которых проживают V. harveyi и V. parahaemolyticus , и V. cholerae нет.

LuxR принадлежит к семейству регуляторов транскрипции TetR, большому классу белков, особенно распространенных в бактериях, подвергающихся воздействию изменений окружающей среды, таких как почвенные бактерии и патогены растений и животных (Ramos et al ., 2005). Белки типа TetR играют важную роль в адаптации организмов к колебаниям окружающей среды. Эти белки характеризуются консервативным ДНК-связывающим мотивом спираль-виток-спираль, но в регуляторных доменах не обнаружено консервативной последовательности, что подтверждает их роль в ответах на различные стимулы (Ramos et al. ., 2005; Molina-Henares). и др. ., 2006; De Silva и др. ., 2007). Все хорошо охарактеризованные белки типа TetR действуют как репрессоры, где связывание молекулы-индуктора [такой как тетрациклин (Tet) с TetR] вызывает конформационные изменения, и белок типа TetR больше не связывается с ДНК (Hinrichs et al. ., 1994; Orth и др. ., 1999). LuxR/HapR являются единственными членами семейства TetR, которые, по-видимому, действуют как активаторы и репрессоры (Showalter et al. ., 1990; Kovacikova and Skorupski, 2002; Pompeani et al. ., 2008). Одним из возможных механизмов активации является то, что LuxR/HapR изгибает ДНК в благоприятную конформацию для активации транскрипции. Другая возможность заключается в том, что LuxR/HapR взаимодействует с холоферментом РНК-полимеразы (РНКП), облегчая активацию транскрипции.В соответствии с этими идеями, статическое и индуцированное белком изгибание ДНК предоставляет бактериям устройства интеграции сигналов для распознавания входных сигналов окружающей среды (Perez-Martin and de Lorenzo, 1997).

Хотя механизм, с помощью которого LuxR активирует экспрессию qrr у V. harveyi , еще предстоит определить, мы знаем, что экспрессия генов qrr требует, чтобы LuxO~P работал в сочетании с альтернативным сигма-фактором σ 54 (Lilley and Bassler, 2000; Lenz и др. ., 2004). σ 54 -промоторы обладают уникальной особенностью, заключающейся в том, что связанные с ними активаторы (например, LuxO˜P) могут функционировать на расстоянии, обычно 100–200 п.н., за счет образования петли ДНК для установления контакта с холоферментом РНКП (Wigneshweraraj et al ., 2008). ). Архитектура σ 54 -зависимых промоторов делает их идеальными для того, чтобы позволить дополнительным факторам (например, LuxR) связываться и обеспечивать оптимальную геометрию промотора для активации транскрипции. Действительно, Fis, небольшой гомодимер белка, который обычно изгибает ДНК на 90° при связывании с родственными сайтами-мишенями (Perez-Martin et al ., 1994) связывается с промежуточной последовательностью ДНК между LuxO˜P и сайтами связывания σ 54 –РНКП и требуется для активации qrr у V. cholerae (и предположительно у V. harveyi ) (Lenz and Басслер, 2007). В случае LuxR сайты связывания в промоторах V. harveyi qrr 2, qrr 3 и qrr 4 расположены относительно далеко, примерно на 30–40 п.н. выше сайта связывания LuxO~P, чем типичны для сайтов связывания вспомогательных факторов транскрипции, что позволяет предположить, что LuxR не функционирует по обычному механизму активации.Например, связывание LuxR с промоторами qrr 2, qrr 3 и qrr 4 может блокировать связывание негативного регулятора, консервативного в E. coli , что приводит к активации экспрессии (см. ). В настоящее время мы изучаем механизм, с помощью которого LuxR действует как активатор.

Малые регуляторные РНК, функционирующие в петлях обратной связи, недавно стали важными регуляторными модулями как у бактерий, так и у высших организмов (Gottesman et al ., 2006; Tsang и др. ., 2007). МикроРНК (миРНК) аналогичны бактериальным малым РНК и обеспечивают посттранскрипционную регуляцию генов в эукариотических организмах путем связывания с комплементарными последовательностями в 3′-UTR мРНК. Крупномасштабный компьютерный анализ данных экспрессии генов в клетках млекопитающих показывает, что регуляция miRNA-опосредованной обратной связи, как положительная, так и отрицательная, является повторяющейся темой, которая, вероятно, усиливает надежность регуляции генов (Tsang et al. ., 2007). Недавно было показано, что двойная отрицательная петля обратной связи, включающая несколько миРНК, контролирует решение судьбы нейронов у нематоды Caenorhabditis elegans (Johnston et al ., 2005). В Pseudomonas fluorescens CHAO три избыточные мРНК – RsmXYZ секвестрируют белки RsmA и RsmE, которые также могут по обратной связи активировать транскрипцию rsmXYZ (Kay et al. ., 2005; 2006, 6.9 et 9046; Reimmann 4.3 et 9046). 2005), аналогичной регуляции обратной связи LuxR-Qrr, представленной в этом исследовании. Важность петель обратной связи, опосредованных sRNA, в быстрых реакциях на стресс у E. coli и Salmonella typhimurium подчеркивается RybB, sRNA, которая активируется альтернативным сигма-фактором σ E .RybB оказывает обратное воздействие, подавляя экспрессию σ E , что имеет решающее значение для гомеостаза клеточной оболочки. В условиях мембранного стресса RybB также необходим для быстрой элиминации мРНК, кодирующих определенные белки внешней мембраны (Papenfort et al. ., 2006; Thompson et al. ., 2007). Учитывая, что петли положительной обратной связи обычно управляют необратимыми процессами, подобными переключателям, специфическая роль регуляторных РНК в регуляции отрицательной обратной связи может заключаться в тонкой настройке, т.е.е. для установки и поддержания стабильного состояния целевого белка (Tsang et al. ., 2007). По сравнению с репрессорами транскрипции регуляторные РНК могут быть особенно эффективны, потому что они контролируют свои белки-мишени на посттранскрипционном уровне и, таким образом, ускоряют ответ на исходящие входы. Эта способность, вероятно, приводит к эффективной буферизации шумов и обеспечивает равномерную экспрессию целевого белка в популяции (Leung and Sharp, 2007).

Анализ топологии сети в E.coli предсказывают, что половина ее транскрипционных факторов негативно саморегулируются (Rosenfeld et al , 2002). Сходным образом LuxR репрессирует собственную транскрипцию (Chatterjee et al. , 1996). Негативная ауторегуляция ускоряет время отклика на изменения экспрессии генов, а также ограничивает выходы транскрипции узкими диапазонами, несмотря на широко колеблющиеся входные данные (Rosenfeld et al. ., 2002; Seshasayee et al. ., 2006). Поскольку LuxR является основным регулятором транскрипции большого набора генов-мишеней QS в V.harveyi , важно, чтобы уровни LuxR строго контролировались, чтобы гарантировать, что популяция вызывает точно рассчитанный по времени паттерн экспрессии генов в ответ на изменение концентрации AI. Описанная здесь петля обратной связи LuxR-sRNA может быть особенно эффективной в модулировании изменений экспрессии генов, поскольку уровни белка LuxR отрицательно контролируются как на посттранскрипционном, так и на транскрипционном уровнях. Предположительно, двойные петли отрицательной обратной связи, которые контролируют уровни LuxR, обеспечивают однородную экспрессию LuxR в популяции клеток, что имеет решающее значение для обеспечения синхронности в групповом поведении.

Экспериментальные процедуры

Бактериальные штаммы и условия роста

Все штаммы V. harveyi получены из ВВ120 (Bassler et al. ., 1997) и выращены в аэробных условиях при 30°C в Луриа-марине (LM) или морской Бульон для биотестирования аутоиндуктора (AB). E. coli S17–1λ pir использовали для размножения плазмид при 37°C в среде LB. Использовали следующие антибиотики: ампициллин, 100 мкг мл -1 ; Tet, 10 мкг мл -1 ; канамицин (Kan), 100 мкг мл -1 ; хлорамфеникол (Cm), 10 мкг мл -1 ; гентамицин, 100 мкг мл -1 и полимикцин В, 50 ЕД мл -1 .Бактериальный рост контролировали путем измерения оптической плотности при 600 нм.

Манипуляции с ДНК

Все манипуляции с ДНК проводили с использованием стандартных процедур (Sambrook et al. ., 1989). ДНК-полимеразу, усиленную Herculase (Stratagene), использовали для ПЦР-реакций клонирования, а Taq-полимеразу (Roche) использовали для всех остальных ПЦР-реакций. dNTP, эндонуклеазы рестрикции и ДНК-лигаза Т4 были получены от New England BioLabs. Наборы для очистки ДНК были предоставлены QIAGEN.Последовательности праймеров доступны по запросу. делеции V. harveyi были сконструированы с использованием ранее описанных методов (Datsenko and Wanner, 2000), а конструкции были введены в хромосому V. harveyi путем аллельной замены (Bassler et al ., 1993). Для конструирования мутантов LuxR-bs предполагаемые сайты связывания LuxR в промоторах qrr 2 и qrr 4 были мутированы в последовательность TTAGTTTGATCTGCTTAATAAA, которая не связывается с LuxR, как было показано с помощью анализа сдвига геля ( А.Помпеани, неопублик. данные). Для сайта связывания qrr 3 LuxR два основания были изменены на TAGTGAATTAATTCAGCATTA вместо того, чтобы рандомизировать весь сайт, поскольку рандомизация всего сайта серьезно влияла на экспрессию qrr 3. Мутации LuxR-bs для qrr 2,3,4 были встроены в праймеры, используемые в методе замены генов, как описано ранее (Datsenko and Wanner, 2000). Слияния промоторов qrr-gfp были клонированы в pSLS3, производное pCMW1 (Waters and Bassler, 2006), с использованием сайтов рестрикции BclI и SalI.Плазмиды трансформировали в Е. coli в 0,2 см кюветах для электропорации (USA Scientific) с использованием Bio-Rad Micro Pulser TM .

Анализы изменения подвижности в геле

LuxR и HapR очищали с помощью системы очистки белка IMPACT (NEB) с использованием экспрессионной плазмиды pTYB11 и протокола, описанного в инструкциях производителя. Очищенный LuxR хранили в 20 л Трис (рН 7,5), 1 ЕДТА, 10 НС NaCL и 0,1 ДТТ с 20% глицерином, как описано ранее (Waters and Bassler, 2006).ДНК-зонды для анализа сдвига подвижности геля были созданы с использованием 5′-меченых флуоресцентных праймеров в стандартной реакции ПЦР, которая амплифицирует 275 пар оснований перед каждым промотором qrr . Зонды очищали после электрофореза в агарозном геле с использованием набора Zymoclean Gel DNA Recovery Kit (Zymo Research). Каждый зонд (10 нМ) инкубировали с указанным количеством LuxR (6,25–500 нМ) и 1 мкл 1 мг мл -1 poly dIdC в конечном объеме 20 мкл при 30°С в течение 15 мин. Сдвиги подвижности геля выполняли на 5% ТАЭ-полиакриламидном геле и визуализировали с использованием системы визуализации Storm 860 (Molecular Dynamics).

Анализ экспрессии gfp

Все анализы экспрессии gfp проводили на клеточном сортере Becton Dickinson FACSAria, а данные анализировали с использованием программного обеспечения FACS Diva. Для мониторинга экспрессии qrr-gfp в E. coli культуры выращивали в 2 мл LB + Tet, Cm в течение 12 ч в трех повторностях при 30°C с аэрацией. Штамм E. coli , используемый в исследованиях экспрессии gfp , представляет собой MC4100. Аллель luxO D47E был клонирован в pBBR322 в сайтах EcoRI и BamHI и интегрирован в сайт λ att с помощью метода λInCh2, как описано ранее (Boyd et al ., 2000) для получения штамма KT1190. Либо luxR на pLAFR2 (pKM699), либо пустой вектор pLAFR2 трансформировали в штамм KT1190 вместе с репортерной конструкцией qrr-gfp для проведения анализа.

Анализы биолюминесценции

Экспрессию биолюминесценции Vibrio harveyi измеряли в анализе, который был описан ранее (Bassler et al. ., 1993). Вкратце, культуры V. harveyi выращивали в течение 14 ч в среде LM при 30°C с аэрацией.Культуры разбавляли 1:5000 и после этого каждые 45 минут измеряли светопродукцию и ОП 600 . Относительные световые единицы (RLU) определяются как отсчеты min -1 мл -1 /OD 600 . Для экспериментов с кривой доза-реакция культуры выращивали в течение 14 часов в среде AB, а затем разбавляли 1:1000 в свежей среде AB. В 96-луночном титрационном микропланшете 90 мкл культуры добавляли к 5 мкл 100 мкМ HAI-1 и 5 мкл 100 мкМ AI-2, и производили серийные разведения до конечных концентраций 10 пМ в сумме обоих HAI-1. и АИ-2.Культуры выращивали в течение 6 ч в четырех повторностях и измеряли биолюминесценцию и ОП 600 с использованием планшет-ридера Perkin Elmer EnVision.

Количественный ПЦР-анализ в реальном времени

Штаммы Vibrio harveyi выращивали в течение 14 часов, а затем разбавляли 1:500. Клетки осаждали при LCD (OD 600 ~0,025) и HCD (OD 600 -1,5) и замораживали при -80°C. РНК выделяли с использованием набора Ribo-Pure TM -Bacteria (Ambion/ABI). Образцы обрабатывали ДНКазой I (Ambion/ABI).РНК количественно определяли на спектрофотометре NanoDrop® ND-1000 (NanoDrop Technologies). ПЦР-анализ в реальном времени проводили, как описано ранее (Tu and Bassler, 2007). hfq использовали в качестве эндогенного контроля, а праймеры доступны по запросу.

Нозерн-блот-анализ

Культуры Vibrio harveyi выращивали до ОП 600 -1,5 в среде LM с 5 мкМ каждого HAI-1 и AI-2. Культуры дважды промывали и ресуспендировали в ЛМ без ИА.Аликвоты для получения РНК собирали в указанные моменты времени после добавления свежей среды, смешивали с 0,2 объема стоп-раствора и быстро замораживали в жидком азоте (Papenfort et al. ., 2008). После оттаивания на льду общую РНК выделяли, как описано (Svenningsen et al. ., 2008). Нозерн-блоты выполняли, как описано (Martin et al. , 1989), за исключением того, что одноцепочечные ДНК-зонды получали с помощью асимметричной ПЦР. Последовательности праймеров доступны по запросу.Сначала мембраны исследовали на наличие Qrr4, затем удаляли путем промывания 0,5% SDS в течение 30 минут при 95°C и повторно исследовали на наличие мРНК LuxR и, наконец, удаляли и повторно исследовали на наличие 5S РНК. Интенсивность сигналов определяли количественно с использованием системы анализа изображений Alpha Innotech FluorChem.

разработка блока питания для светодиодной ленты. Изменение яркости светодиодов или контроллер своими руками Регулировка яркости светодиода схема

Простейшая схема светодиодного диммера, представленная в этой статье, может быть с успехом применена в тюнинге автомобилей, да и просто для повышения комфорта в машине ночью, например, для подсветки панели приборов, бардачков и так далее.Чтобы собрать это изделие, вам не нужны технические знания, просто будьте внимательны и аккуратны.
Напряжение 12 вольт считается полностью безопасным для человека. Если вы используете в своей работе светодиодную ленту, то можно считать, что от пожара вы тоже не пострадаете, так как лента практически не нагревается и не может загореться от перегрева. Но нужна аккуратность в работе, чтобы не допустить короткого замыкания в смонтированном устройстве и в результате пожара, а значит сохранить свое имущество.
Транзистор Т1, в зависимости от марки, может регулировать яркость светодиодов суммарной мощностью до 100 Вт при условии его установки на радиатор охлаждения соответствующей площади.
Работу транзистора Т1 можно сравнить с работой обычного водопроводного крана, а потенциометра R1 с его рукояткой. Чем больше вы поворачиваетесь, тем больше воды течет. Так вот. Чем больше вы отключаете потенциометр, тем больше течет ток. Крутишь — меньше течет и светодиоды меньше светят.

Схема регулятора

Для этой схемы нам понадобится немного деталей.
Транзистор Т1. Вы можете применить КТ819 с любой буквой. КТ729. 2Н5490. 2Н6129. 2Н6288. 2SD1761. БД293. БД663. БД705. БД709. БД953. Эти транзисторы нужно выбирать в зависимости от того, какой мощностью светодиода вы планируете управлять. От мощности транзистора зависит и его цена.
Потенциометр R1 может быть любого сопротивления от трех до двадцати кОм. Потенциометр на три килоома лишь немного уменьшит яркость светодиодов.Десять килоом — сведет почти до нуля. Двадцать — отрегулируйте от середины шкалы. Выберите то, что подходит вам больше всего.
Если вы используете светодиодную ленту, то вам не придется заморачиваться с расчетом демпфирующего сопротивления (на схемах R2 и R3) по формулам, т.к. эти сопротивления уже заложены в ленту при изготовлении и все что вам нужно это подключить его к напряжению 12 вольт. Только нужно купить ленту конкретно на напряжение 12 вольт. Если будете подключать ленту, то исключите сопротивления R2 и R3.
Также производят светодиодные сборки, рассчитанные на питание 12 вольт, и светодиодные лампы для автомобилей. Во все эти устройства при изготовлении встраиваются гасящие резисторы или силовые драйверы и они напрямую подключаются к бортовой сети машины. Если вы только делаете первые шаги в электронике, то лучше использовать именно такие устройства.
Итак, с компонентами схемы мы определились, пора приступать к сборке.


Крепим транзистор к радиатору охлаждения болтом через теплопроводящую изолирующую прокладку (чтобы не было электрического контакта между радиатором и бортовой сетью автомобиля, во избежание короткого замыкания).


Нарежьте проволоку на куски нужной длины.


Чистим от изоляции и лужим жестью.


Зачищаем контакты светодиодной ленты.


Припаяйте провода к ленте.


Неизолированные контакты защищаем клеевым пистолетом.


Припаиваем провода к транзистору и изолируем термоусадочной трубкой.


Припаяйте провода к потенциометру и изолируйте их термоусадочной трубкой.

В этой статье описывается, как собрать простую, но эффективную регулировку яркости светодиодов на основе ШИМ диммирования () светодиодного освещения.

Светодиоды

(светоизлучающие диоды) являются очень чувствительными компонентами. Если ток или напряжение питания превышают допустимое значение, это может привести к их выходу из строя или значительному сокращению срока службы.

Обычно ток ограничивается резистором, включенным последовательно со светодиодом, или регулятором тока цепи (). Увеличение тока на светодиоде увеличивает его интенсивность, а уменьшение тока уменьшает.Одним из способов управления яркостью свечения является использование переменного резистора () для динамического изменения яркости.

Но это применимо только к одному светодиоду, так как даже в одной партии могут быть диоды с разной силой света и это повлияет на неравномерность свечения группы светодиодов.

Широтно-импульсная модуляция. Гораздо более эффективный метод регулирования яркости свечения с помощью применения (ШИМ). При ШИМ на группы светодиодов подается рекомендуемый ток, при этом возможно диммирование за счет подачи питания с высокой частотой.Изменение периода вызывает изменение яркости.

Рабочий цикл можно рассматривать как отношение времени включения и выключения питания, подаваемого на светодиод. Например, если мы рассмотрим цикл в одну секунду и при этом светодиод будет 0,1 секунды выключен, а 0,9 секунды включен, то получится, что свечение будет около 90% от номинального значения.

Описание диммера ШИМ

Самый простой способ добиться этого высокочастотного переключения — использовать ИС, одну из самых распространенных и универсальных ИС из когда-либо созданных.Схема ШИМ-контроллера, показанная ниже, предназначена для использования в качестве диммера для питания светодиодов (12 вольт) или регулятора скорости для двигателя постоянного тока на 12 вольт.

В этой схеме резисторы светодиодов необходимо отрегулировать, чтобы обеспечить прямой ток 25 мА. В результате суммарный ток трех линеек светодиодов составит 75мА. Транзистор должен быть рассчитан на ток не менее 75 мА, но лучше брать с запасом.

Эта схема диммера регулируется от 5 % до 95 %, но при использовании германиевых диодов вместо , диапазон может быть расширен с 1 % до 99 % от номинального значения.

Каждому радиолюбителю знакома микросхема NE555 (аналог КР1006). Его универсальность позволяет конструировать самые разнообразные самоделки: от простого импульсного одиночного вибратора с двумя элементами в жгуте до многокомпонентного модулятора. В данной статье будет рассмотрена схема включения таймера в режиме генератора прямоугольных импульсов с регулировкой ширины импульса.

Схема и принцип работы

С развитием мощных светодиодов NE555 снова вышел на арену в качестве диммера (диммера), напомнив о своих неоспоримых преимуществах.Устройства на его основе не требуют глубоких познаний в электронике, быстро собираются и надежно работают.

Известно, что есть два способа управления яркостью светодиода: аналоговый и импульсный. Первый способ заключается в изменении амплитудного значения постоянного тока через светодиод. У этого метода есть один существенный недостаток – низкая эффективность. Второй способ предполагает изменение ширины импульса (скважности) тока с частотой от 200 Гц до нескольких килогерц. На таких частотах мерцание светодиодов незаметно для человеческого глаза.Схема ШИМ-регулятора с мощным выходным транзистором показана на рисунке. Он способен работать от 4,5 до 18 В, что говорит о возможности управления яркостью как одного мощного светодиода, так и всей светодиодной ленты. Диапазон регулировки яркости составляет от 5 до 95%. Устройство представляет собой модифицированную версию генератора прямоугольных импульсов. Частота этих импульсов зависит от емкости С1 и сопротивлений R1, R2 и определяется по формуле: f=1/(ln2*(R1+2*R2)*C1), Гц

Принцип работы электронного диммера следующий.В момент подачи напряжения питания конденсатор начинает заряжаться по цепи: +Uпит — R2 — VD1 -R1 -C1 — -U питания. Как только напряжение на нем достигнет уровня 2/3U, внутренний транзистор таймера откроется и начнется процесс разрядки. Разрядка начинается с верхней пластины С1 и далее по цепи: R1 — VD2 -7 выход ИМС — колодец -U. Достигнув отметки 1/3U, транзистор таймера закроется и С1 снова начнет набирать емкость.В дальнейшем процесс циклически повторяется, формируя прямоугольные импульсы на выводе 3.

Изменение сопротивления подстроечного резистора приводит к уменьшению (увеличению) длительности импульсов на выходе таймера (вывод 3), и как следствие, уменьшается (увеличивается) среднее значение выходного сигнала. Сформированная последовательность импульсов через токоограничивающий резистор R3 поступает на затвор VT1, включенный по схеме с общим истоком. Нагрузка в виде светодиодной ленты или последовательно соединенных светодиодов большой мощности включается в разрыв цепи стока VT1.

В данном случае установлен мощный MOSFET транзистор с максимальным током стока 13А. Это позволяет управлять свечением светодиодной ленты длиной в несколько метров. Однако для транзистора может потребоваться радиатор.

Блокировочный конденсатор С2 устраняет влияние помех, которые могут возникнуть в цепи питания в момент переключения таймера. Значение его емкости может быть любым в пределах 0,01-0,1 мкФ.

Плата и монтажные детали диммера

Односторонняя печатная плата имеет размер 22х24 мм.Как видно по картинке, на ней нет ничего лишнего, что могло бы вызвать вопросы.

После сборки схема ШИМ-диммера не требует наладки, а печатная плата несложна в изготовлении своими руками. На плате, кроме подстроечного резистора, использованы SMD элементы.

  • DA1 — IC NE555;
  • VT1 — полевой транзистор IRF7413;
  • ВД1,ВД2 — 1Н4007;
  • R1 — 50 кОм, тюнинг;
  • R2, R3 — 1 кОм;
  • С1 — 0.1 мкФ;
  • С2 — 0,01 мкФ.

Транзистор VT1 необходимо подбирать в зависимости от мощности нагрузки. Например, для изменения яркости одноваттного светодиода будет достаточно биполярного транзистора с максимально допустимым током коллектора 500 мА.

Яркость светодиодной ленты должна управляться от источника напряжения +12 В и соответствовать напряжению его питания. В идеале регулятор должен питаться от стабилизированного блока питания, специально предназначенного для ленты.

Нагрузка в виде отдельных мощных светодиодов питается по-разному.В этом случае стабилизатор тока служит источником питания диммера (его еще называют драйвером для светодиода). Его номинальный выходной ток должен соответствовать току последовательно соединенных светодиодов.

Читайте также

PWM диммер для МК ATmega8, на батарейках, с индикацией заряда.

Статья предназначена для лиц с некоторыми познаниями в радиоэлектронике, а именно:

  • что такое микроконтроллер и как его прошить,
  • что такое ШИМ регулирование,
  • что такое светодиодный драйвер.

Проект задумывался для установки на велосипед. Как это все началось. Мы с друзьями часто участвовали в ночных велопрогулках, поэтому нам понадобилась фара для велосипеда. Ну не хотелось ставить обычный фонарик… Нужно было что-то более функциональное. Например, при регулировке яркости «малая/средняя/максимальная», а так как в качестве источника питания планировалось использовать литий-ионный аккумулятор, понадобился еще и индикатор уровня заряда. Я видел много подобных проектов в интернете, но как-то они меня не устраивали.Например, мне попадались проекты ШИМ-диммеров, но в них либо не было индикатора уровня заряда, либо индикатор уровня заряда был на 1…3 светодиодах, но такая малоинформативность мне не понравилась. Ну делай, делай, а я взялся за сборку своего проекта. Итак, в качестве индикатора заряда беру 10 светодиодов, точнее беру светодиодную «столбик», вот так:

Данную светодиодную «колонку» я заказывал в интернет-магазине (в нашем городе нет радиомагазинов), поэтому приедет только через пару недель.Вместо них я временно поставил 10 обычных светодиодов.

В качестве управляющего микроконтроллера я использовал ATmega8 (или ATmega328), так как в этом МК есть АЦП, с помощью которого я организовал измерение уровня заряда аккумулятора. Также этот МК имеет достаточное количество пинов (а мы хотим подключить целых 10 светодиодов). Этот микроконтроллер распространен в радиомагазинах, и стоит относительно дешево — в пределах 50…100 рублей, в зависимости от жадности магазина и типа корпуса.

Чтобы понять, как работает устройство, давайте посмотрим на блок-схему:

В этой статье описано только то, что касается ШИМ-контроллера (левая часть блок-схемы), а драйвер светодиода и сам светодиод вы выбираете на свой вкус, тот, который вам больше всего подходит.Драйвер ZXSC400 меня устраивает, поэтому буду рассматривать его как пример.

ШИМ-контроллер должен быть подключен к светодиодному драйверу с функцией диммирования (DIM, PWM и т. д.), такому как ZXSC400. Вы можете использовать любой другой подходящий драйвер, если он поддерживает ШИМ-управление яркостью и питается от той же батареи, что и ШИМ-контроллер. Для тех, кто не знает, что такое драйвер светодиода, поясню: драйвер нужен для того, чтобы светодиод светился одинаково ярко как при заряженном, так и при разряженном аккумуляторе.Другими словами, драйвер светодиода поддерживает стабильный ток через светодиод.

Типовая схема подключения драйвера светодиодов ZXSC400:

Питание этой схемы необходимо подключить к питанию нашего ШИМ-контроллера, а выход ШИМ с контроллера подключить к входу «STDN» драйвера ZXSC400. Выход «STDN» как раз и служит для регулировки яркости с помощью ШИМ-сигнала. Аналогичным образом можно подключить ШИМ-контроллер ко многим другим драйверам светодиодов, но это отдельная тема.

Алгоритм работы устройства. При подаче питания МК отображает уровень заряда батареи в течение 1 секунды (на светодиодной шкале из 10 светодиодов), затем светодиодная шкала гаснет, МК переходит в режим энергосбережения и ожидает команд управления. Все управление я сделал на одну кнопку, чтобы меньше тянуть проводов на байке. При удержании кнопки более 1 секунды включается ШИМ-регулятор, на выход ШИМ подается сигнал со скважностью 30% (1/3 яркости светодиода). При повторном удержании кнопки более 1 секунды ШИМ-контроллер выключается, на выход ШИМ не поступает сигнал (скважность 0%).При кратковременном нажатии кнопки яркость переключается с 30% — 60% — 100%, а заряд батареи отображается в течение 1 секунды. Таким образом, однократное нажатие изменяет яркость светодиода, а длительное нажатие включает/выключает светодиод. Для проверки работоспособности ШИМ-регулятора я подключил к его выходу обычный светодиод, но еще раз повторюсь — исключительно с целью проверки работоспособности. В дальнейшем подключу ШИМ-контроллер к драйверу ZXSC400. Более подробно и наглядно работа устройства показана на видео (ссылка в конце статьи).

На следующей диаграмме также показан процесс регулировки яркости:

Что делать, если эти значения яркости не устраивают? Например, вы хотите, чтобы это было так: 1%, затем 5%, затем 100%. Я рассматривал и этот вариант. Теперь пользователь может установить эти три значения яркости на все, что захочет! Для этого я написал небольшую программу, которая на основе нужных значений формирует файл для прошивки EEPROM. Прошив этот файл в микроконтроллер, яркость изменится соответственно на желаемую.Прилагаю скриншот окна программы:

Если не прошить файл EEPROM, то значения яркости останутся «по умолчанию» — 30%, 60%, 100%. Правильно собранное устройство не нуждается в настройке. При желании можно только настроить минимальную, среднюю и максимальную яркость по своему усмотрению. Программа и инструкция по использованию находятся в конце статьи.

Выберите аккумулятор для использования. Я использовал литий-ионный аккумулятор из-за его распространенности и дешевизны.Но в схеме я предусмотрел перемычку J1, с помощью которой можно выбрать то, что используем в качестве питания.

Если перемычка J1 находится в положении «1», используется одна литий-ионная батарея. Если перемычка J1 находится в положении «2», то используются три обычные батареи типа AAA/AA/C/D, соединенные последовательно. Перемычка J1 необходима для корректного отображения уровня заряда аккумулятора, так как рабочее напряжение Li-ion аккумулятора находится примерно в пределах 3,3…4,2 В, а у обычных аккумуляторов рабочее напряжение примерно равно 3.0…4,5 В. Таблицы соответствия напряжения аккумулятора показаниям индикатора я прикрепил внизу статьи.

Светодиодные индикаторы. Светодиоды, отображающие уровень заряда аккумулятора, могут быть любыми. Регулировать их яркость в небольших пределах можно изменением номинала токоограничивающего резистора R1. Для отображения уровня заряда используется динамическая индикация, за счет чего достигается экономия энергии, так как единовременно горит только один светодиод. Также можно посмотреть видео об индикации уровня заряда аккумулятора (ссылка в конце статьи).

Микроконтроллер может быть либо ATmega8, либо ATmega328. Оба этих микроконтроллера совместимы по расположению контактов, а отличаются только содержимым «прошивки». Я использовал ATmega328, так как этот МК был в наличии. Для снижения энергопотребления микроконтроллер питается от внутреннего RC-генератора с частотой 1 МГц. Программа микроконтроллера была написана в среде 4.3.6.61 (или 4.3.9.65).

В схеме используется микросхема источника опорного напряжения TL431.С его помощью достигается хорошая точность измерения напряжения аккумулятора. Питание на TL431 подается с вывода PC1 микроконтроллера через резистор R3. Подача напряжения на TL431 происходит только во время индикации уровня заряда. После того, как светодиоды индикации погаснут, напряжение питания отключается, что позволяет экономить заряд батареи. Микросхему TL431 можно найти в вышедших из строя компьютерных блоках питания, в сломанных зарядных устройствах для сотовых телефонов, в импульсных блоках питания от ноутбуков и различного электронного оборудования.Я использовал TL431 в корпусе SOIC-8 (вариант smd), но TL431 чаще встречается в корпусе TO-92, поэтому сделал несколько вариантов печатной платы.

Об эмуляции в программе «». Проект в Proteus работает некорректно. Из-за того, что модель ATmega8 не просыпается, а также с тормозами, отображается динамическая индикация. Если после запуска проекта сразу зажать кнопку, чтобы включился ШИМ-регулятор, то все работает. Но стоит выключить ШИМ-контроллер, снова зажав кнопку, как МК уйдет в сон и больше не проснется (до перезапуска проекта).Не прикрепляю проект в Proteus. Кто хочет поиграть — пишите, отправлю проект в Proteus.

Основные технические характеристики:

  • Напряжение питания, при котором гарантируется работоспособность: 2,8…5 вольт
  • Частота сигнала ШИМ: 244 Гц
  • Частота динамической индикации шкалы из 10 светодиодов: 488 Гц (на 10 светодиодов) или 48,8 Гц (на светодиод)
  • Количество циклически переключаемых режимов яркости: 3 режима
  • Возможность изменения пользователем яркости каждого режима: Да

Ниже вы можете скачать прошивки для МК ATmega8 и ATmega328

Шутов Максим, г. Вельск

Перечень радиоэлементов
Обозначение Тип А Номинал Количество Записка Оценка Мой блокнот
У1 MK AVR 8-бит

ATmega8-16PU

1 В блокнот
У2 Справочная ИС

TL431ILP

1 В блокнот
Резисторы
Р1, Р2 Резистор постоянный SMD 1206

330 Ом

2 В блокнот
Р3 Резистор постоянный SMD 1206

1 кОм

1 В блокнот
Р4 Резистор постоянный SMD 1206

10 кОм

1 В блокнот
Р5 Резистор постоянный SMD 1206

47 кОм

1 В блокнот
Постоянный резистор SMD 1206

Светодиоды используются почти во всех технологиях вокруг нас.Правда, иногда возникает необходимость отрегулировать их яркость (например, в фонариках, или мониторах). Самым простым выходом из этой ситуации видится изменение величины тока, проходящего через светодиод. Но это не так. Светодиод является довольно чувствительным компонентом. Постоянное изменение величины тока может значительно сократить срок его службы, а то и вовсе сломать. Также следует учитывать, что ограничительный резистор использовать нельзя, так как в нем будет накапливаться избыточная энергия. Это не допускается при использовании аккумуляторов.Еще одна проблема с этим подходом заключается в том, что цвет света будет меняться.

Есть два варианта:

Эти методы контролируют ток, протекающий через светодиод, но между ними есть определенные различия.
Аналоговое регулирование изменяет уровень тока, проходящего через светодиоды. А ШИМ регулирует частоту подачи тока.

ШИМ-регулирование

Выходом из этой ситуации может стать использование широтно-импульсной модуляции (ШИМ). При такой системе светодиоды получают необходимый ток, а яркость регулируется подачей питания с высокой частотой.То есть частота периода подачи изменяет яркость светодиодов.
Несомненный плюс системы ШИМ — сохранение производительности светодиода. КПД будет около 90%.

Типы ШИМ-регулирования

  • Двухпроводное. Часто используется в системе освещения автомобилей. Блок питания преобразователя должен иметь схему, формирующую ШИМ-сигнал на выходе постоянного тока.
  • Шунтирующее устройство. Чтобы сделать период включения/выключения преобразователя, используйте шунтирующий компонент, который обеспечивает путь для выходного тока помимо светодиода.

Параметры импульса для ШИМ

Частота следования импульсов не меняется, поэтому требований к определению яркости света нет. В этом случае изменяется только ширина или время положительного импульса.

Частота импульсов

Даже с учетом того, что к частоте особых претензий нет, есть граничные индикаторы. Они определяются чувствительностью человеческого глаза к мерцанию. Например, если в кино мерцание кадров должно быть 24 кадра в секунду, чтобы наш глаз воспринимал это как одно движущееся изображение.
Чтобы мерцание света воспринималось как равномерный свет, частота должна быть не менее 200 Гц. По верхним показателям ограничений нет, а вот ниже нет.

Как работает ШИМ-контроллер

Для непосредственного управления светодиодами используется транзисторный ключевой каскад. Обычно в них используются транзисторы, способные накапливать большое количество энергии.
Это необходимо при использовании светодиодных лент или мощных светодиодов.
Для небольшого количества или малой мощности вполне достаточно применение биполярных транзисторов.Вы также можете подключить светодиоды непосредственно к микросхемам.

Генераторы ШИМ

В системе ШИМ в качестве задающего генератора может использоваться микроконтроллер или схема, состоящая из схем малой степени интеграции.
Также возможно создание регулятора из микросхем, которые предназначены для коммутации блоков питания, или микросхем логики К561, или интегрального таймера NE565.
Умельцы даже используют для этой цели операционный усилитель. Для этого на нем собран генератор, который можно регулировать.
Одна из наиболее часто используемых схем основана на таймере 555. По сути, это обычный генератор прямоугольных импульсов. Частота регулируется конденсатором С1. на выходе конденсатор должен иметь высокое напряжение (это же и при подключении к плюсу питания). И заряжается при низком напряжении на выходе. В этот момент возникают импульсы разной ширины.
Еще одна популярная схема — ШИМ на микросхеме UC3843. в данном случае схема включения изменена в сторону упрощения.Для управления шириной импульса используется управляющее напряжение положительной полярности. В этом случае на выходе получается нужный импульсный сигнал ШИМ.
Управляющее напряжение действует на выходе следующим образом: при уменьшении широта увеличивается.

Почему ШИМ?

  • Основным преимуществом этой системы является простота. Шаблоны использования очень просты и легко реализуемы.
  • Система управления PWM обеспечивает очень широкий диапазон регулировки яркости.Если говорить о мониторах, то возможно использование CCFL-подсветки, но в этом случае яркость можно уменьшить только вдвое, так как CCFL-подсветка очень требовательна к величине тока и напряжения.
  • С помощью ШИМ можно держать ток на постоянном уровне, а значит светодиоды не пострадают и цветовая температура не изменится.

Недостатки использования ШИМ

  • Со временем мерцание изображения может стать весьма заметным, особенно при низкой яркости или движении глаз.
  • Если освещение постоянно яркое (например, солнечный свет), изображение может стать размытым.

Что можно сделать с транзистором. Как работает транзистор? Включение транзисторов по схеме с общей базой ОБ

Доброго времени суток, уважаемые радиолюбители!
Добро пожаловать на сайт ““

В этом уроке Начинающие радиолюбительские школы мы продолжим изучение полупроводников … На прошлом уроке мы рассмотрели диоды , а в этом уроке рассмотрим более сложный полупроводниковый элемент — транзисторы .

Транзистор имеет более сложную полупроводниковую структуру, чем диод … Он состоит из трех слоев кремния (есть и германиевые транзисторы) с разной проводимостью. Это могут быть структуры n-p-n или p-n-p. Функционирование транзисторов, как и диодов, основано на свойствах p-n переходов.

Центральный, или средний слой, называется базовым (Б), а два других соответственно — эмиттерным (Е) и коллекторным (ТО).Следует отметить, что существенной разницы между двумя типами транзисторов нет, и многие схемы можно собрать с тем или иным типом, соблюдая при этом соответствующую полярность питания. На рисунке ниже приведена принципиальная схема транзисторов, p-n-p транзистор отличается от транзистора n-p-n направлением эмиттера стрелки:

Существует два основных типа транзисторов: биполярный и однополярный , отличающиеся конструктивными особенностями.Внутри каждого типа существует множество разновидностей. Основное отличие этих двух типов транзисторов состоит в том, что управление процессами, происходящими при работе прибора, осуществляется в биполярном транзисторе по входному току, а в униполярном — по входному напряжению.

Биполярные транзисторы , как было сказано выше, представляют собой трехслойный слоеный пирог. В упрощенном виде транзистор можно представить как два встречно включенных диода:

(следует отметить, что переход база-эмиттер представляет собой обычный стабилитрон, напряжение стабилизации которого равно 7 … 10 вольт). Исправность транзистора можно проверить так же, как и исправность диода, обычным омметром, измерив сопротивление между его выводами. Переходы, подобные тем, которые встречаются в диоде, существуют в транзисторе между базой и коллектором, а также между базой и эмиттером. На практике этот метод используется очень часто для проверки транзисторов. Если между выводами коллектора и эмиттера подключить омметр, прибор покажет обрыв цепи (при исправном транзисторе), что естественно, так как диоды включены в обратную сторону.Это означает, что при любой полярности приложенного напряжения один из диодов включается в прямом направлении, а второй в обратном, поэтому ток проходить не будет.

Объединение двух пар переходов приводит к проявлению чрезвычайно интересного свойства, называемого эффектом транзистора … Если на транзистор между коллектором и эмиттером подать напряжение, то тока практически не будет (о чем речь шла чуть выше ). Если сделать соединение в соответствии со схемой (как на рисунке ниже), где к базе через ограничительное сопротивление приложено напряжение (чтобы не повредить транзистор), то будет проходить ток сильнее тока базы через коллектор.С увеличением тока базы увеличивается и ток коллектора.

С помощью измерительного прибора можно определить соотношение токов базы, коллектора и эмиттера. Это можно проверить простым способом. Если поддерживать напряжение питания, например, на уровне 4,5 В, изменив значение сопротивления в цепи базы от R до R/2, то ток базы удвоится, а ток коллектора будет пропорционально увеличиваться, например:

Следовательно, при любом напряжении на сопротивлении R ток коллектора будет в 99 раз больше тока базы, то есть транзистор имеет коэффициент усиления по току, равный 99.Другими словами, транзистор усиливает ток базы в 99 раз. Этот коэффициент обозначается буквой ? . Коэффициент усиления равен отношению тока коллектора к току базы:

? = Ик/Иб

Можно подать на базу транзистора и переменное напряжение… Но, необходимо, чтобы транзистор работал в линейном режиме. Для нормальной работы в линейном режиме на базу транзистора следует подать постоянное напряжение смещения и переменное напряжение, которое он будет усиливать.Таким образом, транзисторы усиливают слабые напряжения, например от микрофона, до уровня, который может управлять громкоговорителем. Если усиления недостаточно, можно использовать несколько транзисторов или их последовательные каскады. Чтобы не нарушать режимы работы каждого из них по постоянному току (при котором обеспечивается линейность) при соединении каскадов применяют развязывающие конденсаторы. Биполярные транзисторы имеют электрические характеристики, которые дают им явные преимущества перед другими усилительными компонентами.

Как мы уже знаем, существуют также (помимо биполярных) и униполярные транзисторы… Кратко рассмотрим два из них — полевых и однопереходных транзисторов. Как и биполярные, они бывают двух типов и имеют три выхода:

Электродами полевого транзистора являются: затвор, — З, сток, — С, соответствующий коллектору и исток, — И, отождествляемые с эмиттером. N- и p-канальные полевые транзисторы отличаются направлением стрелки затвора. Транзисторы с одним переходом, иногда называемые диодами с двойной базой, в основном используются в схемах импульсно-периодических генераторов сигналов.

Существуют три основные схемы включения транзисторов в усилительном каскаде:

?

общий эмиттер (и)

?

с общим коллектором (б)

?

с общей базой (в)

Биполярный транзистор с общим эмиттером в зависимости от выходного сопротивления источника питания R1 и сопротивления нагрузки Rн усиливает входной сигнал как по напряжению, так и по току. Коэффициент усиления биполярного транзистора обозначается как х31э (читается: ясень-два-один-е, где е — схема с общим эмиттером), и у каждого транзистора он разный.Значение коэффициента h31e (полное его название статический коэффициент передачи тока базы h31e ) зависит только от толщины базы транзистора (изменению не подлежит) и от напряжения между коллектором и эмиттером, поэтому при малом напряжении (менее 20 В) его коэффициент передачи тока при любом токе коллектора практически не меняется и несколько увеличивается с увеличением напряжения на коллекторе.

Коэффициент усиления по току – Кус.и и коэффициент усиления по напряжению – Кус.u биполярного транзистора, включенного по схеме с общим эмиттером, зависит от соотношения сопротивления нагрузки (обозначено на схеме Rn) и источника сигнала (обозначено на схеме R1). Если сопротивление источника сигнала х31э в раза меньше сопротивления нагрузки, то коэффициент усиления по напряжению несколько меньше единицы (0,95…0,99), а коэффициент усиления по току равен х31э. При сопротивлении источника сигнала более чем в х31э в раза меньше сопротивления нагрузки, то коэффициент усиления по току остается неизменным (равным х31э ), а коэффициент усиления по напряжению уменьшается.Если, наоборот, входное сопротивление уменьшить, то коэффициент усиления по напряжению становится больше единицы, а коэффициент усиления по току при ограничении тока, протекающего через переход база-эмиттер транзистора, не изменяется. Схема с общим эмиттером является единственной схемой включения биполярных транзисторов, требующей ограничения входного (управляющего) тока. Можно сделать несколько выводов: — ток базы транзистора необходимо ограничивать, иначе сгорит либо транзистор, либо схема, управляющая им; — с помощью транзистора, включенного по схеме ОЭ, очень легко управлять высоковольтной нагрузкой при низковольтном источнике сигнала.Через базу, а значит и коллекторные переходы, протекает значительный ток при напряжении база-эмиттер всего 0,8…1,5 В. Если амплитуда (напряжение) больше этого значения, необходимо установить токоограничивающий резистор (R1). располагать между базой транзистора и выходом схемы управления. Рассчитать его сопротивление можно по формулам:

Ir1 = Irн/h31э R1 = Ucontr/Ir1 Где:

Irн — ток через нагрузку, А; Ucont — напряжение источника сигнала, В; R1 — сопротивление резистора, Ом.

Еще одной особенностью схемы ОЭ является то, что падение напряжения на переходе коллектор-эмиттер транзистора можно практически свести к нулю. Но для этого необходимо значительно увеличить ток базы, что не очень выгодно. Поэтому такой режим работы транзисторов используется только в импульсных, цифровых схемах.

Транзистор , схема аналогового усилителя, должна обеспечивать примерно одинаковое усиление сигналов с разной амплитудой относительно некоторого «среднего» напряжения.Для этого его нужно немного приоткрыть, стараясь не переусердствовать. Как видно на картинке ниже (слева):

ток коллектора и падение напряжения на транзисторе при плавном увеличении тока базы сначала изменяются почти линейно , и только затем, с наступлением насыщения транзистора, прижимаются к осям графика. Нас интересуют только прямые участки линий (вплоть до насыщения) — очевидно, что они символизируют линейное усиление сигнала, то есть при многократном изменении управляющего тока ток коллектора (напряжение в нагрузке) изменится на столько же.

Форма аналогового сигнала представлена ​​на рисунке выше (справа) . Как видно из графика, амплитуда сигнала постоянно пульсирует относительно некоторого среднего напряжения Uср, причем может как увеличиваться, так и уменьшаться. А вот биполярный транзистор реагирует только на увеличение входного напряжения (точнее, тока). Вывод: нужно сделать так, чтобы транзистор даже при минимальной амплитуде входного сигнала был приоткрыт. При средней амплитуде Uav он будет открываться чуть сильнее, а при максимальной Umax — максимально.Но при этом он не должен входить в режим насыщения (см. рисунок выше) — в этом режиме выходной ток перестает линейно зависеть от входного тока, в результате чего происходит сильное искажение сигнала.

Давайте снова посмотрим на аналоговый сигнал. Так как и максимальная, и минимальная амплитуды входного сигнала относительно средней примерно одинаковы по величине (и противоположны по знаку), нам необходимо подать на базу транзистора такой постоянный ток (ток смещения — Iсм), чтобы при «среднем» напряжении на входе транзистор открыт ровно наполовину.Тогда при уменьшении входного тока транзистор закроется и ток коллектора уменьшится, а при увеличении входного тока еще больше откроется.

Есть несколько схем простых устройств и узлов, которые могут изготовить начинающие радиолюбители.

Однокаскадный усилитель ЗЧ

Это простейшая конструкция, позволяющая продемонстрировать усилительные возможности транзистора. Правда, коэффициент усиления по напряжению небольшой — не превышает 6, поэтому область применения такого устройства ограничена.

Тем не менее, его можно подключить, скажем, к детекторной радиостанции (она должна быть нагружена резистором 10 кОм) и использовать гарнитуру BF1 для прослушивания передач местной радиостанции.

Усиленный сигнал подается на входные гнезда Х1, Х2, а напряжение питания (как и во всех других конструкциях этого автора, оно равно 6 В — четыре гальванических элемента с напряжением 1,5 В, соединенных последовательно) подается на домкраты Х3, Х4.

Делитель R1R2 задает напряжение смещения на базе транзистора, а резистор R3 обеспечивает обратную связь по току, что способствует температурной стабилизации усилителя.

Рис.: 1. Схема однокаскадного усилителя ЗЧ на транзисторе.

Как происходит стабилизация? Предположим, что ток коллектора транзистора увеличился под воздействием температуры. Соответственно, увеличится падение напряжения на резисторе R3. В результате ток эмиттера уменьшится, а значит и ток коллектора — достигнет своего начального значения.

Нагрузкой усилительного каскада является гарнитура сопротивлением 60..100 Ом. Проверить работу усилителя несложно, нужно прикоснуться к входному гнезду Х1, например, пинцетом в телефоне должно быть слышно слабое гудение, как следствие наведения переменного тока.Коллекторный ток транзистора около 3 мА.

Двухкаскадный ультразвуковой преобразователь частоты на транзисторах разной структуры

Выполнен с прямой связью между каскадами и глубокой отрицательной обратной связью по постоянному току, что делает его режим независимым от температуры окружающей среды. Основой стабилизации температуры является резистор R4, работающий аналогично резистору R3 в предыдущей конструкции.

Усилитель более «чувствителен» по сравнению с однокаскадным усилителем — коэффициент усиления по напряжению достигает 20.На входные гнезда можно подавать переменное напряжение с амплитудой не более 30 мВ, иначе в наушниках будут слышны искажения.

Проверяют усилитель касанием входного гнезда Х1 пинцетом (или просто пальцем) — в телефоне будет слышен громкий звук. Усилитель потребляет ток около 8 мА.

Рис. 2. Схема двухкаскадного усилителя ЗЧ на транзисторах разной структуры.

Эту конструкцию можно использовать для усиления слабых сигналов, например от микрофона.И конечно значительно усилит сигнал 34 снимаемый с нагрузки детекторного приемника.

Двухкаскадный ультразвуковой преобразователь частоты на транзисторах той же структуры

Здесь также используется прямая связь между каскадами, но стабилизация режима работы несколько отличается от предыдущих конструкций.

Предположим, ток коллектора транзистора VT1 уменьшился. Падение напряжения на этом транзисторе увеличится, что приведет к увеличению напряжения на резисторе R3, подключенном к эмиттерной цепи транзистора VT2.

За счет соединения транзисторов через резистор R2 увеличится ток базы входного транзистора, что приведет к увеличению его коллекторного тока. В результате начальное изменение тока коллектора этого транзистора будет скомпенсировано.

Рис. 3. Схема двухкаскадного усилителя ЗЧ на транзисторах той же структуры.

Чувствительность усилителя очень высокая — коэффициент усиления достигает 100. Коэффициент усиления в значительной степени зависит от емкости конденсатора С2 — если его выключить, коэффициент усиления уменьшится.Входное напряжение должно быть не более 2 мВ.

Усилитель хорошо работает с детекторным приемником, электретным микрофоном и другими источниками слабых сигналов. Потребляемый усилителем ток около 2 мА.

Выполнен на транзисторах разной структуры и имеет коэффициент усиления по напряжению около 10. Наибольшее входное напряжение может составлять 0,1 В.

Первый двухкаскадный усилитель собран на транзисторе VT1, второй — на VT2 и ВТЗ разной структуры. Первый каскад усиливает сигнал напряжения 34, при этом обе полуволны равны.Второй усиливает сигнал тока, но каскад на транзисторе VT2 «работает» с положительными полуволнами, а на транзисторе ВТЗ — с отрицательными.

Рис. 4. Двухтактный усилитель мощности ЗЧ на транзисторах.

Режим постоянного тока выбран таким, чтобы напряжение в точке соединения эмиттеров транзисторов второго каскада было примерно вдвое меньше напряжения источника питания.

Это достигается включением резистора обратной связи R2.Коллекторный ток входного транзистора, протекающий через диод VD1, приводит к падению напряжения на нем. что является напряжением смещения на базах выходных транзисторов (относительно их эмиттеров) — оно позволяет уменьшить искажения усиливаемого сигнала.

Нагрузка (несколько подключенных параллельно наушников или динамическая головка) подключается к усилителю через оксидный конденсатор С2.

Если усилитель будет работать на динамическую головку (сопротивлением 8-10 Ом), то емкость этого конденсатора должна быть минимум в два раза больше.Обратите внимание на подключение нагрузки первого каскада — резистора R4. Его верхний вывод по схеме соединен не с источником питания, как это обычно делается, а с нижним выводом нагрузки.

Это так называемая схема вольтодобавки, при которой небольшое напряжение положительной обратной связи ЗЧ поступает в базовую цепь выходных транзисторов, что выравнивает условия работы транзисторов.

Двухуровневый индикатор напряжения

Такое устройство можно использовать.например, для индикации «разрядки» батарейки или индикации уровня воспроизводимого сигнала в бытовом магнитофоне. Макет индикатора продемонстрирует, как он работает.

Рис. 5. Схема двухуровневого индикатора напряжения.

В нижнем положении движка переменного резистора R1 оба транзистора закрыты, светодиоды HL1, HL2 не горят. При перемещении ползунка резистора вверх напряжение на нем увеличивается. При достижении напряжения открытия транзистора VT1 светодиод HL1 будет мигать

Если продолжить работу двигателя.наступит момент, когда вслед за диодом VD1 откроется транзистор VT2. Светодиод HL2 также будет мигать. Другими словами, при низком напряжении на входе индикатора загорается только светодиод HL1 и больше, чем оба светодиода.

Плавно уменьшая входное напряжение переменным резистором, отмечаем, что сначала гаснет светодиод HL2, а затем HL1. Яркость светодиодов зависит от ограничительных резисторов R3 и R6 по мере увеличения их сопротивлений яркость уменьшается.

Для подключения индикатора к реальному устройству необходимо отсоединить верхний вывод переменного резистора от плюсового провода источника питания и подать контролируемое напряжение на крайние выводы этого резистора.Перемещая его ползунок, выбирается порог срабатывания индикатора.

При контроле только напряжения источника питания допускается установка зеленого светодиода АЛ307Г вместо HL2.

Излучает световые сигналы по принципу меньше нормы — нормально — больше нормы. Для этого в индикаторе используются два красных и один зеленый светодиод.

Рис. 6. Трехуровневый индикатор напряжения.

При определенном напряжении на движке переменного резистора R1 (напряжение в норме) оба транзистора закрыты и (работает только зеленый светодиод HL3).Перемещение ползунка резистора вверх по схеме приводит к увеличению напряжения (больше нормы), на нем открывается транзистор VT1.

Светодиод HL3 гаснет и загорается HL1. Если ползунок переместить вниз и, таким образом, напряжение на нем уменьшится («меньше нормы»), транзистор VT1 закроется, а VT2 откроется. Будет наблюдаться следующая картина: сначала погаснет светодиод HL1, затем загорится и вскоре погаснет HL3, и, наконец, начнет мигать HL2.

Из-за низкой чувствительности индикатора получается плавный переход от гашения одного светодиода к загоранию другого еще не полностью погасшего, например, HL1, но уже горит HL3.

Триггер Шмитта

Как вы знаете, это устройство обычно используется для преобразования медленно меняющегося напряжения в сигнал прямоугольной формы. Когда ползунок переменного резистора R1 находится в нижнем по схеме положении, транзистор VT1 закрыт.

Напряжение на его коллекторе высокое, в результате транзистор VT2 оказывается открытым, а значит горит светодиод HL1. На резисторе R3 образуется падение напряжения.

Рис. 7. Простой триггер Шмитта на двух транзисторах.

Медленно перемещая ползунок переменного резистора вверх по схеме, можно будет достичь момента, когда транзистор VT1 резко откроется, а VT2 закроется. Это произойдет, когда напряжение на базе VT1 превысит падение напряжения на резисторе R3.

Светодиод погаснет. Если затем переместить ползунок вниз, курок вернется в исходное положение — светодиод начнет мигать. Это произойдет, когда напряжение на ползунке будет меньше, чем напряжение выключения светодиода.

Ожидающий мультивибратор

Такое устройство имеет одно стабильное состояние и переходит в другое только при подаче входного сигнала. При этом мультивибратор вырабатывает импульс собственной длительности независимо от длительности входного сигнала. Убедимся в этом, проведя эксперимент со схемой предлагаемого устройства.

Рис. 8. Принципиальная схема ждущего мультивибратора.

В исходном состоянии транзистор VT2 открыт, светодиод HL1 горит.Теперь достаточно закоротить пазы Х1 и Х2, чтобы импульс тока через конденсатор С1 открыл транзистор VT1. Напряжение на его коллекторе уменьшится и конденсатор С2 будет подключен к базе транзистора VT2 в такой полярности, что он закроется. Светодиод погаснет.

Конденсатор начинает разряжаться, ток разряда будет протекать через резистор R5, удерживая VT2 закрытым. Как только конденсатор разрядится, транзистор VT2 снова откроется и мультивибратор снова перейдет в дежурный режим.

Длительность импульса, формируемого мультивибратором (длительность нахождения в неустойчивом состоянии) не зависит от длительности триггера, а определяется сопротивлением резистора R5 и емкостью конденсатора С2.

Если параллельно С2 подключить конденсатор такой же емкости, то светодиод будет гореть в два раза дольше.

И. Бокомчев. Р-06-2000.

Мы узнали как устроен транзистор, в общих чертах рассмотрели технологии изготовления германиевых и кремниевых транзисторов и разобрались как они маркируются .

Сегодня мы проведем несколько экспериментов и убедимся, что биполярный транзистор действительно состоит из двух диодов , включенных встречно, и что транзистор является усилителем сигнала .

Нужен маломощный германиевый транзистор p-n-p структуры из серии МП39 — МП42, лампа накаливания, рассчитанная на напряжение 2,5 Вольта и блок питания на 4 — 5 Вольт. В общем, начинающим радиолюбителям рекомендую собрать небольшой регулируемый, с помощью которого вы будете питать свои конструкции.

1. Транзистор состоит из двух диодов.

Чтобы в этом убедиться, соберем небольшую схему: базу транзистора VT1 подключим к минусу источника питания, а вывод коллектора к одному из выводов лампы накаливания EL … Теперь если второй вывод лампы соединить с плюсом источника питания, то лампа загорится.

Лампочка загорелась потому, что мы подали на коллекторный переход транзистора прямой — пропускное напряжение, открывшее коллекторный переход и протекшее через него постоянный ток коллекторный … Величина этого тока зависит от сопротивления нити накала лампы и внутреннего сопротивления источника питания.

Теперь посмотрим на ту же схему, но транзистор изобразим в виде полупроводниковой пластины.

Основные носители заряда в базе электроны , преодолевая p-n переход, попадают в дырочную область коллектор и становятся минорными. Став неосновными, базовые электроны поглощаются основными носителями в дырочной области коллектора отверстий … Точно так же дырки из области коллектора, попадая в электронную область базы, становятся неосновными и поглощаются основными носителями заряда в базе. электрона .

Базовый контакт, подключенный к отрицательному полюсу источника питания, будет действовать практически неограниченным количеством электронов , восполняя распад электронов из базовой области. А контакт коллектора, подключенный к положительному полюсу источника питания через нить накала лампы, способен принять такое же количество электронов, благодаря чему концентрация дырок в области базы .

Таким образом, проводимость p-n перехода станет большой, а сопротивление току будет маленьким, а значит через коллекторный переход будет протекать коллекторный ток. Ик … А что больше этот ток будет ярче лампа будет гореть.

Лампочка также будет гореть, если он включен в цепь эмиттерного перехода. На рисунке ниже показан именно этот вариант схемы.

Теперь немного изменим схему и базу транзистора. VT1 подключить к плюс блок питания. В этом случае лампа гореть не будет, так как мы включили p-n переход транзистора в обратном направлении. А это значит, что сопротивление p-n перехода стало большим и через него протекает очень мало обратный ток коллекторный икбо неспособный нити накала лампы накаливания EL … В большинстве случаев этот ток не превышает несколько микроампер.

И чтобы окончательно в этом убедиться, снова рассмотрим схему с транзистором, изображенную в виде полупроводниковой пластины.

Электроны в области основания переместятся на плюс источник питания, удаляясь от p-n перехода. Отверстия в области коллектора , также будут отдаляться от p-n перехода, перемещаясь к отрицательному полюсу питания. В результате граница областей как бы расширится , из-за чего образуется обедненная дырками и электронами зона, которая будет обеспечивать высокое сопротивление току.

Но, так как в каждой из областей базы и коллектора находится неосновных носителей заряда, то небольшие обмена электронами и дырками между областями все равно будут происходить.Поэтому через коллекторный переход будет протекать ток, во много раз меньший, чем постоянный, и этого тока будет недостаточно для зажигания нити накала лампы.

2. Работа транзистора в режиме переключения.

Проведем еще один опыт, показывающий один из режимов работы транзистора.
Между коллектором и эмиттером транзистора подключаем последовательно соединенный блок питания и такую ​​же лампу накаливания. Соединяем плюс блока питания с эмиттером, а минус через нить накала лампы с коллектором.Лампа выключена. Почему?

Все очень просто: если подать питающее напряжение между эмиттером и коллектором, то при любой полярности один из переходов будет в прямом направлении, а другой в обратном и будет мешать прохождению тока. В этом нетрудно убедиться, если посмотреть на следующий рисунок.

На рисунке видно, что переход база-эмиттер-эмиттер включен в прямом направлении и открыт и готов принять неограниченное количество электронов.Коллекторный переход база-коллектор, наоборот, включается в обратном направлении и препятствует прохождению электронов на базу.

Отсюда следует, что основные носители заряда в эмиттерной области дырок , отталкиваясь от плюса источника питания, устремляются в область базы и там взаимно поглощают (рекомбинируют) с основными носителями заряда в базе электронов … В момент насыщения, когда ни с одной из сторон не останется свободных носителей заряда, их движение прекратится, а значит, и ток перестанет течь.Почему? Потому что со стороны коллектора не будет перезарядки электронов.

Получается, что основные носители заряда в коллекторе отверстий притягиваются к отрицательному полюсу источника питания, а часть из них взаимно поглощает электроны , поступающие с отрицательной стороны источника питания. А в момент насыщения, когда свободных носителей заряда будет не более , дырки в силу своего преобладания в области коллектора будут блокировать дальнейшее прохождение электронов к базе.

Таким образом, между коллектором и базой образуется обедненная дырками и электронами зона, которая будет обеспечивать высокое сопротивление току.

Конечно, благодаря магнитному полю и тепловому воздействию, мизерный ток все равно будет течь, но сила этого тока настолько мала, что он не в состоянии накалить нить накала лампы.

Теперь добавляем в схему перемычку и замыкаем на нее базу с эмиттером. Лампочка, включенная в коллекторную цепь транзистора, больше не загорится.Почему?

Потому что при замыкании базы и эмиттера перемычкой коллекторный переход становится просто диодом, на который поступает противоположное напряжение. Транзистор находится в закрытом состоянии и через него протекает лишь небольшой обратный коллекторный ток Ikbo .

Теперь еще немного изменим схему и добавим резистор Rb сопротивлением 200 — 300 Ом, и еще один источник напряжения GB в виде пальчиковой батарейки.
Минус батареи соедините через резистор Rb с базой транзистора, а плюс батареи с эмиттером. Лампа загорелась.

Лампа загорелась потому, что мы подключили батарейку между базой и эмиттером и тем самым подали на эмиттерный переход прямое отпирающее напряжение. Эмиттерный переход открылся и через него пошло прямых тока, которые открыли коллекторный переход транзистора. Транзистор открылся и по цепи эмиттер-база-коллектор коллекторный ток капает Iк , во много раз превышающий ток цепи эмиттер-база …И благодаря этому току зажегся свет.

Если поменять полярность батареи и подать плюс на базу, то эмиттерный переход закроется, а вместе с ним закроется и коллекторный переход. Через транзистор Икбо потечет обратный коллекторный ток и лампочка погаснет.

Резистор Rb ограничивает ток в базовой цепи. Если ток не ограничивать и все 1,5 вольта подать на базу, то через эмиттерный переход будет протекать слишком большой ток, в результате чего произойдет тепловой пробой перехода и транзистор выйдет из строя.Как правило, для германиевых транзисторов отпирающее напряжение не более 0,2 вольт, а для кремний не более 0,7 вольта.

И снова разберем ту же схему, но представим транзистор в виде полупроводниковой пластины.

При подаче отпирающего напряжения на базу транзистора он открывает эмиттер переход и свободные дырки от эмиттера начинают взаимопоглощаться с электронами базы создавая небольшой прямой базовый ток .

Но не все дырки, введенные из эмиттера в базу, рекомбинируют с ее электронами. Типично площадь базы делают тонкой , а при изготовлении транзисторов структуры pnp концентрацию дырок в эмиттере и коллекторе делают во много раз больше, чем концентрацию электронов в базе , поэтому только небольшая часть дырок поглощается электронами базы.

Основная масса дырок эмиттера проходит базу и падает под действием более высокого отрицательного напряжения, действующего в коллекторе, и уже вместе с дырками коллектора движется к его отрицательному контакту, где взаимно поглощается введенными электронами отрицательный полюс источника питания ГБ .

В результате сопротивление коллекторной цепи эмиттер-база-коллектор уменьшится и в ней протекает постоянный ток коллектора во много раз больше тока базы цепи эмиттер-база .

Чем больше больше дырок введено от эмиттера к базе, значит значительнее тока в цепи коллектора. И наоборот у меньше отпирающее напряжение на базе, у меньше ток в коллекторной цепи.

Если в момент работы транзистора в цепи базы и коллектора включить миллиамперметр, то при закрытом транзисторе токов в этих цепях практически не будет.

Когда транзистор открыт, ток базы Ib будет 2-3 мА, а ток коллектора Ik будет около 60 — 80 мА. Все это говорит о том, что транзистор может быть усилителем тока .

В этих экспериментах транзистор находился в одном из двух состояний: открытом или закрытом.Переключение транзистора из одного состояния в другое происходило под действием отпирающего напряжения на базе … Такой режим транзистора называется режим переключения или ключ … Такой режим работы транзистора называется используются в приборах и устройствах автоматики.

На этом мы закончим, а в следующей части разберем работу транзистора на примере простого усилителя звуковой частоты, собранного на одном транзисторе.
Удачи!

Литература:

1. Борисов В.Г. — Юный радиолюбитель. 1985
2. Э. Айсберг — Транзистор? .. Это очень просто! 1964

Транзистор — это полупроводниковое устройство, которое может усиливать, преобразовывать и генерировать электрические сигналы. Первый работоспособный биполярный транзистор был изобретен в 1947 году. Материалом для его изготовления послужил германий. А уже в 1956 году родился кремниевый транзистор.

В биполярном транзисторе используются два типа носителей заряда — электроны и дырки, поэтому такие транзисторы называются биполярными.Помимо биполярных транзисторов существуют униполярные (полевые) транзисторы, в которых используется только один тип носителей — электроны или дырки. Эта статья будет охватывать.

Большинство кремниевых транзисторов имеют структуру n-p-n, что также объясняется технологией изготовления, хотя есть и кремниевые транзисторы типа p-n-p, но их несколько меньше, чем n-p-n структур. Такие транзисторы используются в составе комплементарных пар (транзисторы разной проводимости с одинаковыми электрическими параметрами).Например, КТ315 и КТ361, КТ815 и КТ814, а в выходных каскадах транзисторных УМЗЧ КТ819 и КТ818. В импортных усилителях часто используется мощная комплиментарная пара 2SA1943 и 2SC5200.

Часто транзисторы структуры pnp называют транзисторами прямой проводимости, а структуры npn обратной . Почему-то такое название почти не встречается в литературе, но в кругу радиоинженеров и радиолюбителей используется повсеместно , все сразу понимают о чем речь.На рис. 1 показано схематическое устройство транзисторов и их условные графические обозначения.

Рисунок 1.

Помимо разницы в типе проводимости и материале, биполярные транзисторы классифицируются по мощности и рабочей частоте. Если мощность рассеяния на транзисторе не превышает 0,3 Вт, такой транзистор считается маломощным. При мощности 0,3…3 Вт транзистор называют транзистором средней мощности, а при мощности свыше 3 Вт — большой мощностью.Современные транзисторы способны рассеивать мощность в несколько десятков и даже сотен ватт.

Транзисторы неодинаково хорошо усиливают электрические сигналы: с увеличением частоты коэффициент усиления транзисторного каскада уменьшается, а при определенной частоте и вовсе прекращается. Поэтому для работы в широком диапазоне частот выпускаются транзисторы с разными частотными свойствами.

По рабочей частоте транзисторы делятся на низкочастотные, — рабочая частота не более 3 МГц, среднечастотные — 3… 30 МГц, высокочастотный — свыше 30 МГц. Если рабочая частота превышает 300 МГц, то это уже транзисторы СВЧ.

Вообще в серьезных толстых справочниках приведено более 100 различных параметров транзисторов, что тоже говорит об огромном количестве моделей. А количество современных транзисторов таково, что разместить их в полном объеме ни в одном справочнике уже невозможно. А модельный ряд постоянно увеличивается, позволяя решать практически все поставленные разработчиками задачи.

Существует множество транзисторных схем (достаточно вспомнить количество хотя бы бытовой техники) для усиления и преобразования электрических сигналов, но, при всем разнообразии, эти схемы состоят из отдельных каскадов, основу которых составляют транзисторы. Для достижения требуемого усиления сигнала необходимо использовать несколько последовательно соединенных каскадов усиления. Чтобы понять, как работают усилительные каскады, необходимо более подробно познакомиться со схемами включения транзисторов.

Сам по себе транзистор ничего усиливать не может. Его усилительные свойства заключаются в том, что небольшие изменения входного сигнала (тока или напряжения) приводят к значительным изменениям напряжения или тока на выходе каскада за счет потребления энергии от внешнего источника. Это свойство широко используется в аналоговых схемах — усилителях, телевизорах, радио, связи и т. д.

Для упрощения изложения здесь будем рассматривать схемы на n-p-n транзисторах.Все, что будет сказано об этих транзисторах, в равной степени относится и к p-n-p транзисторам. Достаточно лишь поменять полярность источников питания, и, если таковые имеются, получить рабочую схему.

Всего используется три таких схемы: схема с общим эмиттером (ОЭ), схема с общим коллектором (ОК) и схема с общей базой (ОБ). Все эти схемы показаны на рис. 2.

Рисунок 2.

Но прежде чем перейти к рассмотрению этих схем, следует ознакомиться с тем, как работает транзистор в ключевом режиме.Это знакомство должно облегчить понимание в режиме усиления. В некотором смысле ключевую схему можно рассматривать как своего рода схему оригинального оборудования.

Работа транзистора в ключевом режиме

Перед изучением работы транзистора в режиме усиления сигнала стоит вспомнить, что транзисторы часто используются в ключевом режиме.

Этот режим работы транзистора рассматривался давно. В августовском номере журнала «Радио» 1959 года была опубликована статья Г.Лавров «Полупроводниковый триод в ключевом режиме». Автор статьи предложил изменить длительность импульсов в обмотке управления (ОУ). Сейчас этот метод регулирования называется ШИМ и используется довольно часто. Диаграмма из журнала того времени показана на рисунке 3.

Рисунок 3.

Но ключевой режим используется не только в ШИМ-системах. Часто транзистор просто что-то включает и выключает.

В этом случае в качестве нагрузки можно использовать реле: подан входной сигнал — реле включено, нет — реле выключено.Вместо реле в ключевом режиме часто используются лампочки. Обычно это делается для индикации: горит свет или нет. Схема такого ключевого каскада представлена ​​на рисунке 4. Ключевые каскады также используются для работы со светодиодами или с оптронами.

Рисунок 4.

На рисунке каскад управляется обычным контактом, хотя может быть и цифровая микросхема или . Автомобильный свет, используется для подсветки приборной панели в «Жигулях». Следует обратить внимание на то, что управляющее напряжение 5В, а коммутируемое коллекторное напряжение 12В.

В этом нет ничего странного, так как напряжения в этой цепи не играют никакой роли, имеют значение только токи. Поэтому лампочка может быть хоть на 220В, если транзистор рассчитан на работу на такие напряжения. Напряжение коллекторного источника также должно соответствовать рабочему напряжению нагрузки. С помощью таких каскадов нагрузка подключается к цифровым микросхемам или микроконтроллерам.

В этой схеме ток базы управляет током коллектора, который за счет энергии источника питания в несколько десятков, а то и сотен раз (в зависимости от нагрузки коллектора) превышает ток базы.Легко видеть, что имеет место усиление тока. При работе транзистора в ключевом режиме обычно для расчета каскада пользуются величиной, называемой в справочниках «коэффициентом усиления по току в режиме большого сигнала» — в справочниках она обозначается буквой β. Это отношение тока коллектора, определяемого нагрузкой, к минимально возможному току базы. В виде математической формулы это выглядит так: β = Iк/Iб.

У большинства современных транзисторов коэффициент β достаточно велик, как правило, от 50 и выше, поэтому при расчете ключевого каскада его можно принять равным всего 10.Даже если ток базы окажется больше расчетного, то транзистор от этого больше не откроется, тогда он и режим ключа.

Чтобы зажечь лампочку, показанную на рисунке 3, Iб = Iк/β = 100мА/10 = 10мА, это не менее. При управляющем напряжении 5В на базовом резисторе Rб за вычетом падения напряжения на участке БЭ останется 5В — 0,6В = 4,4В. Сопротивление базового резистора будет: 4,4В/10мА = 440 Ом. Резистор на 430 Ом выбирается из стандартного ассортимента.Напряжение 0,6В — это напряжение на переходе Б-Е, и об этом нельзя забывать в расчетах!

Чтобы база транзистора не оставалась «висящей в воздухе» при размыкании управляющего контакта, переход В-Е обычно шунтируют резистором Rбэ, надежно закрывающим транзистор. Не следует забывать и об этом резисторе, хотя в некоторых схемах его почему-то нет, что может привести к ложному срабатыванию каскада от помех. Собственно, об этом резисторе знали все, но почему-то забыли, и в очередной раз наступили на «грабли».

Номинал этого резистора должен быть таким, чтобы при размыкании контакта напряжение на базе было бы не менее 0,6В, иначе каскад будет неуправляемым, как если бы участок ВЕ был просто закорочен. На практике резистор Rbe устанавливают номиналом примерно в десять раз больше, чем Rb. Но даже при номинале Rb 10кОм схема будет работать достаточно надежно: потенциалы базы и эмиттера будут равны, что приведет к закрытию транзистора.

Такой ключевой каскад при исправной работе может включать лампочку на полный накал, либо полностью выключать.При этом транзистор может быть полностью открыт (состояние насыщения) или полностью закрыт (состояние отсечки). Сразу, конечно, напрашивается вывод, что между этими «пограничными» состояниями есть такое, когда лампочка полна света. В этом случае транзистор наполовину открыт или наполовину закрыт? Это как в задаче о наполнении стакана: оптимист видит стакан наполовину наполненным, а пессимист видит его наполовину пустым. Такой режим работы транзистора называется усилительным или линейным.

Работа транзистора в режиме усиления сигнала

Практически вся современная электронная техника состоит из микросхем, в которых «спрятаны» транзисторы. Достаточно просто выбрать режим работы операционного усилителя, чтобы получить необходимое усиление или полосу пропускания. Но, несмотря на это, часто применяются каскады на дискретных («разбросных») транзисторах, а потому понимание работы усилительного каскада просто необходимо.

Наиболее распространенным включением транзистора по сравнению с ОК и ОБ является схема с общим эмиттером (ОЭ).Причиной такой распространенности является, прежде всего, высокий коэффициент усиления по напряжению и току. Наибольший коэффициент усиления каскада ОЭ обеспечивается при падении половины напряжения питания Эпит/2 на коллекторной нагрузке. Соответственно вторая половина приходится на К-Е участок транзистора. Это достигается настройкой каскада, о которой речь пойдет ниже. Этот режим усиления называется классом А.

При включении транзистора с ОЭ выходной сигнал на коллекторе находится в противофазе с входным.В качестве недостатков можно отметить маленькое входное сопротивление ОЭ (не более нескольких сотен Ом), а выходное — в пределах десятков кОм.

Если в ключевом режиме транзистор характеризуется коэффициентом усиления по току в режиме большого сигнала β, то в режиме усиления используется «коэффициент усиления по току в режиме малого сигнала», обозначаемый в справочниках h31e. Такое обозначение произошло от представления транзистора в виде четырехполюсника. Буква «е» указывает на то, что измерения производились при включенном транзисторе с общим эмиттером.

Коэффициент h31e, как правило, несколько больше β, хотя и его можно использовать при расчетах в первом приближении. Все равно разброс параметров β и h31e настолько велик даже для одного типа транзистора, что расчеты носят приблизительный характер. После таких расчетов, как правило, требуется настройка схемы.

Коэффициент усиления транзистора зависит от толщины базы, поэтому его нельзя изменить. Отсюда и большой разброс в коэффициентах усиления транзисторов, взятых даже из одной коробки (читай одной партии).Для маломощных транзисторов этот коэффициент колеблется в пределах 100…1000, а для мощных транзисторов 5…200. Чем тоньше база, тем выше коэффициент.

Простейшая схема включения транзистора ОЭ показана на рисунке 5. Это всего лишь небольшой кусочек от рисунка 2, показанного во второй части статьи. Это называется цепью с фиксированным базовым током.

Рисунок 5.

Схема предельно проста. Входной сигнал поступает на базу транзистора через блокировочный конденсатор С1, и, усиливаясь, снимается с коллектора транзистора через конденсатор С2.Назначение конденсаторов — защитить входные цепи от постоянной составляющей входного сигнала (вспомним только угольный или электретный микрофон) и обеспечить необходимую полосу пропускания каскада.

Резистор R2 является коллекторной нагрузкой каскада, а R1 обеспечивает смещение постоянного тока на базу. С помощью этого резистора стараются сделать так, чтобы напряжение на коллекторе было Эпит/2. Это состояние называется рабочей точкой транзистора, в этом случае коэффициент усиления каскада максимален.

Примерное сопротивление резистора R1 можно определить по простой формуле R1 ≈ R2*h31э/1,5…1,8. Коэффициент 1,5…1,8 подставляется в зависимости от напряжения питания: при низком напряжении (не более 9В) значение коэффициента не более 1,5, а начиная с 50В приближается к 1,8…2,0. Но, действительно, формула настолько приблизительна, что чаще всего приходится подбирать резистор R1, иначе не получится нужное значение Эпит/2 на коллекторе.

Коллекторный резистор R2 ставится как условие задачи, так как от его значения зависит ток коллектора и коэффициент усиления каскада в целом: чем больше сопротивление резистора R2, тем выше коэффициент усиления. Но с этим резистором надо быть осторожным, ток коллектора должен быть меньше максимально допустимого для данного типа транзистора.

Схема очень проста, но эта простота придает ей и отрицательные свойства, и за эту простоту приходится платить.Во-первых, усиление каскада зависит от конкретного экземпляра транзистора: если вы заменили транзистор при ремонте, снова подберите смещение, доведите его до рабочей точки.

Во-вторых, от температуры окружающей среды — с ростом температуры увеличивается обратный ток коллектора Ico, что приводит к увеличению тока коллектора. А где же тогда половина питающего напряжения на коллекторе Эпит/2, такая же рабочая точка? В результате транзистор еще больше нагревается, после чего выходит из строя.Чтобы избавиться от этой зависимости или хотя бы минимизировать ее, в транзисторный каскад вводят дополнительные элементы отрицательной обратной связи — ООС.

На рис. 6 показана схема с фиксированным смещением.

Рисунок 6.

Казалось бы, делитель напряжения Rb-k, Rb-e обеспечит требуемое начальное смещение каскада, но на самом деле такому каскаду присущи все недостатки схемы фиксированного тока. Таким образом, показанная схема является всего лишь вариантом схемы с фиксированным током, показанной на рисунке 5.

Схемы термостабилизации

Ситуация несколько лучше при использовании схем, показанных на рисунке 7.

Рисунок 7.

В коллекторно-стабилизированной схеме резистор смещения R1 подключен не к источнику питания, а к коллектору транзистора. При этом, если обратный ток увеличивается с ростом температуры, транзистор открывается сильнее, напряжение на коллекторе уменьшается. Это уменьшение приводит к уменьшению напряжения смещения, подаваемого на базу через R1.Транзистор начинает закрываться, ток коллектора снижается до допустимого значения, и рабочая точка восстанавливается.

Вполне очевидно, что такая мера стабилизации приводит к некоторому снижению коэффициента усиления каскада, но это не проблема. Недостающее усиление обычно добавляют за счет увеличения числа каскадов усилителя. С другой стороны, такая ООС позволяет значительно расширить диапазон рабочих температур каскада.

Несколько сложнее схемотехника каскада с эмиттерной стабилизацией.Усилительные свойства таких каскадов остаются неизменными в еще более широком диапазоне температур, чем у схемы с коллекторной стабилизацией. И еще одно неоспоримое преимущество — при замене транзистора не придется заново выбирать режимы работы каскада.

Эмиттерный резистор R4, обеспечивающий стабилизацию температуры, также снижает коэффициент усиления каскада. Это для ДК. Чтобы исключить влияние резистора R4 на усиление переменного тока, резистор R4 шунтирован конденсатором Се, представляющим для переменного тока пренебрежимо малое сопротивление.Его значение определяется частотным диапазоном усилителя. Если эти частоты находятся в звуковом диапазоне, то емкость конденсатора может быть от единиц до десятков и даже сотен микрофарад. Для радиочастот это уже сотые или тысячные доли, но в некоторых случаях схема прекрасно работает и без этого конденсатора.

Чтобы лучше понять, как работает эмиттерная стабилизация, необходимо рассмотреть схему включения транзистора с общим коллектором ОК.

Схема с общим коллектором (СС) Показана на рисунке 8. Эта схема является фрагментом рисунка 2 из второй части статьи, где показаны все три схемы включения транзисторов.

Рисунок 8.

Нагрузкой каскада является эмиттерный резистор R2, входной сигнал подается через конденсатор С1, а выходной снимается через конденсатор С2. Тут можно спросить, почему эта схема называется ОК? Действительно, если вспомнить схему ОЭ, то хорошо видно, что эмиттер подключен к общему проводу схемы, относительно которого подается входной сигнал и снимается выходной.

В схеме ОК коллектор просто подключен к источнику питания, и на первый взгляд кажется, что он не имеет никакого отношения к входным и выходным сигналам. Но на самом деле источник ЭДС (аккумулятор питания) имеет очень маленькое внутреннее сопротивление, для сигнала это практически одна точка, такой же контакт.

Более подробно работу схемы ОК можно посмотреть на рисунке 9

Рисунок 9.

Известно, что для кремниевых транзисторов напряжение перехода b-e находится в пределах 0.5…0,7 В, поэтому можно принять в среднем 0,6 В, если не ставится цель проводить расчеты с точностью до десятых долей процента. Поэтому, как видно на рисунке 9, выходное напряжение всегда будет меньше входного напряжения на величину Ub-e, а именно на те же 0,6В. В отличие от схемы OE, эта схема не инвертирует входной сигнал, а просто повторяет его, да еще и уменьшает на 0,6В. Эта схема также называется эмиттерным повторителем. Зачем нужна такая схема, в чем ее польза?

Цепь ОК усиливает сигнал тока в h31e раз, что свидетельствует о том, что входное сопротивление схемы в h31e раз больше, чем сопротивление эмиттерной цепи.Другими словами, можно подавать напряжение прямо на базу (без ограничительного резистора), не опасаясь спалить транзистор. Просто возьмите базовый контакт и подключите его к шине питания + U.

Высокий входной импеданс позволяет подключать источник входного сигнала с высоким импедансом (комплексным импедансом), например, пьезодатчик. Если такой звукосниматель подключить к каскаду по схеме ОЭ, то низкое входное сопротивление этого каскада просто «просадит» сигнал звукоснимателя — «радио играть не будет.»

Отличительной особенностью схемы ОК является то, что ее коллекторный ток Iк зависит только от сопротивления нагрузки и напряжения источника входного сигнала. В данном случае параметры транзистора здесь не играют никакой роли. Говорят, что такие схемы охвачены 100% обратной связью по напряжению.

Как показано на рисунке 9, ток в эмиттерной нагрузке (он же ток эмиттера) Iн = Iк + Iб. Учитывая, что ток базы Iб пренебрежимо мал по сравнению с током коллектора Iк, можно принять, что ток нагрузки равен току коллектора Iн = Iк.Ток нагрузки будет (Uвх — Uбэ)/Rн. При этом будем считать, что Ube известно и всегда равно 0,6В.

Отсюда следует, что ток коллектора Iк = (Uвх — Uбэ)/Rн зависит только от входного напряжения и сопротивления нагрузки. Сопротивление нагрузки можно менять в широких пределах, однако особо усердствовать не нужно. Ведь если вместо Rn поставить гвоздь — сотку, то никакой транзистор не выдержит!

Схема OK позволяет легко измерить статический коэффициент передачи тока h31e.Как это сделать показано на рисунке 10.

Рисунок 10.

Сначала измерьте ток нагрузки, как показано на рис. 10а. При этом базу транзистора никуда подключать не нужно, как показано на рисунке. После этого измеряется базовый ток в соответствии с рисунком 10б. Измерения в обоих случаях следует производить в одних и тех же величинах: либо в амперах, либо в миллиамперах. Напряжение источника питания и нагрузка должны оставаться постоянными в обоих измерениях.Чтобы узнать статический коэффициент передачи тока, достаточно ток нагрузки разделить на ток базы: h31e ≈ In/Ib.

Следует отметить, что при увеличении тока нагрузки h31e несколько уменьшается, а при увеличении напряжения питания увеличивается. Эмиттерные повторители часто имеют двухтактную конструкцию с использованием комплементарных пар транзисторов для увеличения выходной мощности устройства. Такой эмиттерный повторитель показан на рисунке 11.

Рисунок 11.

Рисунок 12.

Включение транзисторов по схеме с общей базой ОВ

Эта схема дает только усиление по напряжению, но имеет лучшие частотные характеристики по сравнению со схемой ОЭ: те же транзисторы могут работать на более высоких частотах. Основное применение схемы ОВ — антенные усилители диапазонов ДМВ. Схема антенного усилителя показана на рисунке 12.

Пожалуй, сегодня сложно представить современный мир без транзисторов, практически в любой электронике, от радиоприемников и телевизоров до автомобилей, телефонов и компьютеров, они так или иначе используются.

Есть два типа транзисторов: биполярный и полевой … Биполярные транзисторы управляются током, а не напряжением. Бывают мощные и маломощные, высокочастотные и низкочастотные, pnp и npn структуры… Транзисторы выпускаются в разных корпусах и бывают разных размеров, начиная от SMD-чипа (на самом деле там гораздо меньше, чем микросхема), которые предназначены для поверхностного монтажа, заканчивая очень мощными транзисторами… По рассеиваемой мощности различают маломощные транзисторы до 100 мВт, средняя мощность от 0.1 на 1 Вт и мощные транзисторы более 1 Вт.

Когда говорят о транзисторах, обычно имеют в виду биполярные транзисторы. Биполярные транзисторы изготавливаются из кремния или германия. Их называют биполярными, потому что их работа основана на использовании как электронов, так и дырок в качестве носителей заряда. Транзисторы на схемах обозначаются так:

Одна из самых внешних областей структуры транзистора называется эмиттером. Промежуточная область называется базой, а другая крайность называется резервуаром.Эти три электрода образуют два p-n перехода: между базой и коллектором — коллектор, а между базой и эмиттером — эмиттер. Как и обычный переключатель, транзистор может находиться в двух состояниях — «включено» и «выключено». Но это не значит, что у них есть движущиеся или механические части, они переключаются с выключения на включение и обратно с помощью электрических сигналов.

Транзисторы

предназначены для усиления, преобразования и генерации электрических колебаний. Работу транзистора можно проиллюстрировать на примере водопроводной системы.Представьте себе смеситель в ванной, один электрод транзистора — это трубка к крану (смесителю), другой (второй) — трубка после крана, откуда вытекает вода, а третий управляющий электрод — это как раз кран, с которого мы включим воду.
Транзистор можно представить как два диода, соединенных последовательно, в случае NPN аноды соединены вместе, а в случае PNP катоды соединены.

Имеются транзисторы типов ПНП и НПН, транзисторы ПНП открываются напряжением отрицательной полярности, НПН — положительной.В NPN транзисторах основными носителями заряда являются электроны, а в PNP — дырки, которые менее подвижны, соответственно NPN транзисторы переключаются быстрее.

Uke = напряжение коллектор-эмиттер
Ube = напряжение база-эмиттер
Ic = ток коллектора
Ib = ток базы

В зависимости от состояний, в которых находятся переходы транзистора, различают режимы его работы. Так как транзистор имеет два перехода (эмиттерный и коллекторный), и каждый из них может находиться в двух состояниях: 1) открыт 2) закрыт.Существует четыре режима работы транзистора. Основным режимом является активный режим, в котором коллекторный переход закрыт, а эмиттерный открыт. Активные транзисторы используются в схемах усиления. Кроме активного различают инверсный режим, при котором эмиттерный переход закрыт, а коллекторный открыт, режим насыщения, при котором оба перехода открыты, и режим отсечки, при котором оба перехода закрыты.

При работе транзистора с высокочастотными сигналами время протекания основных процессов (время движения носителей от эмиттера к коллектору) становится соизмеримым с периодом изменения входного сигнала.В результате способность транзистора усиливать электрические сигналы уменьшается с увеличением частоты.

Некоторые параметры биполярных транзисторов

Коллектор постоянного/импульсного напряжения — эмиттер.
Коллектор постоянного напряжения — база.
Эмиттер постоянного напряжения — база.
Предельная частота коэффициента передачи базового тока
Постоянный/импульсный ток коллектора.
Коэффициент передачи тока
Максимально допустимый ток
Входное сопротивление
Рассеиваемая мощность.
Температура перехода Pn.
Температура окружающей среды и т. д.

Граничное напряжение Укео гр. — максимально допустимое напряжение между коллектором и эмиттером, при разомкнутой цепи базы и тока коллектора. Напряжение коллектора, меньше Укео гр. характерны импульсные режимы работы транзистора при токах базы, отличных от нуля, и соответствующих токах базы (для транзисторов n-p-n ток базы >0, а для p-n-p, наоборот, Iб

К биполярным транзисторам можно отнести однопереходные транзисторы, таковы, например, КТ117.Такой транзистор представляет собой трехэлектродный полупроводниковый прибор с одним p-n переходом. Однопереходный транзистор состоит из двух баз и эмиттера.

В последнее время в схемах стали часто применять составные транзисторы, их называют парными или транзисторами Дарлингтона, они имеют очень высокий коэффициент передачи тока, состоят из двух и более биполярных транзисторов, но и готовые транзисторы выпускаются в один пакет, например TIP140. Включаются с общим коллектором, если подключить два транзистора, то будут работать как один, включение показано на рисунке ниже.Использование подтягивающего резистора R1 улучшает некоторые характеристики составного транзистора.

Некоторые недостатки составного транзистора: низкая производительность, особенно переход с открытого на закрытое. Прямое падение напряжения на переходе база-эмиттер почти в два раза больше, чем у обычного транзистора. Ну и конечно же нужно больше места на доске.

Проверка биполярных транзисторов

Поскольку транзистор состоит из двух переходов, каждый из которых представляет собой полупроводниковый диод, вы можете проверить транзистор так же, как и диод.Транзистор обычно проверяют омметром, проверяют оба p-n перехода транзистора: коллектор-база и эмиттер-база. Для проверки прямого сопротивления p-n-p переходов транзистора отрицательный вывод омметра подключают к базе, а положительный вывод омметра подключают поочередно к коллектору и эмиттеру. Для проверки обратного сопротивления переходов плюсовой вывод омметра подключают к базе. При проверке n-p-n транзисторов подключение производится обратным образом: прямое сопротивление измеряется при подключении к базе положительного вывода омметра, а обратное сопротивление измеряется при подключении к базе отрицательного вывода.Транзисторы также можно прозвонить цифровым мультиметром в режиме прозвонки диодов. Для НПН красный щуп прибора «+» подключают к базе транзистора, а черным щупом «-» поочередно прикасаются к коллектору и эмиттеру. Прибор должен показать какое-то сопротивление, примерно от 600 до 1200. Затем меняем полярность подключения щупов, при этом прибор не должен ничего показывать. Для структуры PNP порядок проверки будет обратным.

Хотелось бы сказать пару слов о MOSFET транзисторах (полевой транзистор металл-оксид-полупроводник), (Metal Oxide Semiconductor (MOS)) — это и есть полевые транзисторы, не путать с обычными полевиками! Полевые транзисторы имеют три вывода: Г — затвор, Д — сток, С — исток.Различают канал N и Р, в обозначении этих транзисторов есть диод Шоттки, он пропускает ток от истока к стоку, и ограничивает напряжение сток — исток.

Применяются в основном для коммутации больших токов, управляются не током, как биполярные транзисторы, а напряжением, и, как правило, имеют очень низкое сопротивление открытого канала, сопротивление канала постоянно и не зависит на текущем. Транзисторы MOSFET специально разработаны для ключевых цепей, можно сказать как замена реле, но в некоторых случаях могут быть усилены, используются в мощных усилителях баса.

Эти транзисторы имеют следующие преимущества:
Минимальная мощность управления и высокий коэффициент усиления по току
Лучшая производительность, например более высокая скорость переключения.
Устойчив к большим импульсам напряжения.
Схемы на таких транзисторах обычно проще.

Минусы:
Дороже биполярных транзисторов.
Боятся статического электричества.
Чаще всего для коммутации силовых цепей используется MOSFET с N-каналом. Управляющее напряжение должно превышать порог в 4 В, в общем случае для надежного включения MOSFET необходимо 10-12 В.Управляющее напряжение — это напряжение, прикладываемое между затвором и истоком для включения МОП-транзистора.

Значения большинства параметров транзисторов зависят от фактического режима работы и температуры, при повышении температуры параметры транзисторов могут измениться. Справочник содержит, как правило, типовые (усредненные) зависимости параметров транзисторов от тока, напряжения, температуры, частоты и т. д.

Для обеспечения надежной работы транзисторов необходимо принять меры по исключению длительных электрических нагрузок, близких к предельно допустимым, например, заменять транзистор на аналогичный, но меньшей мощности не стоит, это касается не только мощности , но и к другим параметрам транзистора.В некоторых случаях для увеличения мощности возможно параллельное соединение транзисторов, когда эмиттер соединен с эмиттером, коллектор с коллектором, а база с базой. Перегрузки могут быть вызваны разными причинами, например, от перенапряжения; быстродействующие диоды часто используются для защиты от перенапряжения.

Что касается нагрева и перегрева транзисторов, то температурный режим транзисторов не только влияет на значение параметров, но и определяет надежность их работы.Следует стремиться к тому, чтобы транзистор не перегревался во время работы; в выходных каскадах усилителей транзисторы необходимо устанавливать на больших радиаторах. Защита транзисторов от перегрева должна обеспечиваться не только при эксплуатации, но и при пайке. При лужении и пайке следует принимать меры для предотвращения перегрева транзистора; Транзисторы во время пайки желательно придерживать пинцетом для защиты от перегрева.

регистрация и установка контрольных вопросов Qq приложение как перевести на английский

Многие мессенджеры предназначены для определенных стран. QQ Messenger — очень популярная в Китае программа . Этот универсальный сервис позволяет быстро обмениваться сообщениями, имеет широкий набор различных функций.

Функции программы

После создания программа стала очень популярной, более 700 миллионов пользователей . Этот мессенджер позволяет не только общаться, но и просматривать новости со всего мир . Кроме того, в последнее время многие используют мессенджеры для улучшения навыков общения на иностранных языках. К характеристикам QQ Messenger можно отнести:

  • встроенная функция видеочат. К особенностям этой функции можно отнести высокое качество передаваемого изображения. В большинстве случаев с ограниченным качеством сталкивались только с владельцами плохих веб-камер. Также следует отметить хорошее качество звука, а также полноэкранное отображение получаемого изображения.
  • Передача файлов происходит с минимальными задержками.


  • Не многие мессенджеры имеют функцию перевода. Скачайте мессенджер qq на русском языке, чтобы общаться на 50 языках. Именно поэтому не обязательно знать языки, чтобы общаться с людьми из других стран.
  • Есть функция поиска других пользователей в системе по определенным параметрам. Учитывая, что общаться можно только с пользователями системы, эта функция пользуется большим спросом.
  • Оптимизация диалоговых окон. Зачастую многие люди общаются сразу с несколькими собеседниками. Быстрое переключение между окнами позволяет быстро отвечать на сообщения.
  • Адресная книга. Также следует учитывать, что контакты пользователей системы могут сохраняться в специальной адресной книге программы, где осуществляется фильтрация по определенным параметрам для поиска нужного человека.
  • Можно создавать заметки и напоминания.
  • Функция отображения мирового времени.
  • Возможность хранить файлы на удаленном жестком диске.
  • Точная история с возможностью фильтрации по определенным параметрам.
  • Возможность создавать собственные темы.
Скачать QQ бесплатно

Среди отличительных особенностей отметим возможность создания нескольких учетных записей и одновременный вход с нескольких копий программ и поэтому скачать qq messenger на русском языке возможно для корпоративного общения. QQ Messenger позволяет настроить автозапуск по нескольким индикаторам, а также есть возможность сворачивать окна в трей.

Мессенджер от Tencent занимает первое место по популярности в Китае. Однако это вовсе не означает, что программа не используется в странах СНГ. Рассмотрим, как зарегистрироваться в QQ на русском телефоне.

Основные трудности

На первый взгляд может показаться, что при регистрации проблем быть не должно. Но с ними сталкиваются многие пользователи из России, что доказывает обратное. Среди основных сложностей стоит выделить:

  • СМС с кодом не получено;
  • Код пришел, но неверный;
  • В ПК версии нет страны «Россия».

Везде все сходится к ключевой ошибке — пользователи используют не международную версию сайта, вводят код страны, которой нет в списке доступных, либо вводят неверные данные.

Как зарегистрироваться по телефону

У приложения QQ International есть официальный сайт. Через него проще всего найти нужный мобильный мессенджер с международной версией.

В первую очередь нужно открыть сайт — http://www.imqq.com/English2033.HTML. Главное не перепутать с qq com, так как откроется страница совсем с другой тематикой.

Если он открылся на китайском языке, в правом верхнем углу нажмите на неизвестные символы и выберите английский язык. Этот раздел обведен кружком на картинке ниже.

Изменение языка сайта

Пролистав сайт вниз, пользователь увидит все преимущества мессенджера.

загрузка

При нажатии на значок «Скачать» откроется окно с QR-кодом и двумя кнопками для загрузки на Android или IOS.Приложение для Windows также существует, оно находится в Магазине Windows.

Если сайт открывается с мобильного устройства, нажимаем на кнопку с нашей ОС и телефон открывает магазин приложений. Так выглядит QQ в Play Market:


Мессенджер для Android

Нажмите кнопку «Установить» и дождитесь завершения загрузки.

Регистрация через приложение

После первого открытия мессенджер предложит вам войти в свой аккаунт.Язык по умолчанию должен быть английский, но если это не так, вы можете изменить язык, нажав на кнопку в правом верхнем углу. Программа доступна на английском, немецком, французском, испанском, а также на нескольких типах китайского языка.

Ввод номера телефона

В правом нижнем углу выберите Зарегистрироваться. Здесь нужно ввести номер мобильного телефона с кодом страны. По умолчанию будет +86 (китайский код). Нажмите на нее и найдите международный код страны.Для быстрого поиска рекомендуется использовать лупу и вводить название страны на английском языке.

Введите номер и дождитесь получения SMS-кода. Подтверждаем номер, после чего нужно выбрать свой никнейм. После ввода ника иногда выдает ошибку на китайском языке. В переводе это означает «Ошибка регистрации, пожалуйста, пришлите свой номер телефона позже».

Объяснение ошибки, решение

Эта ошибка появляется, когда на один и тот же российский телефон приходит не одно СМС с кодом, а два.Из-за этого происходит сбой, и хотя пользователь перескакивает на следующий этап, он зависает на нем.

Перерегистрация никак не поможет, так как появится ошибка. Она укажет, что номер уже привязан к аккаунту QQ, но у него нет пароля. В этом случае следует подождать несколько часов и попробовать пройти повторную регистрацию. Если та же ошибка — подождите сутки, либо введите другой номер телефона.

Номер счета QQ

После того, как вы ввели никнейм, в следующем окне появится ряд цифр, которые нужно запомнить или записать.Это идентификатор учетной записи QQ. Тыкаем на кнопку «Начать», и регистрация считается завершенной.

Добавление пароля

Когда вы входите в свою учетную запись, вам будет предложено добавить пароль в верхней части экрана. Не пренебрегайте этим, так как это поможет вам не потерять доступ к своему аккаунту QQ.

Для этого нажмите на уведомление и введите пароль. Он должен содержать от 6 до 16 символов. Для пароля, состоящего только из цифр, необходимо не менее 9 символов.Сохраняем, тыкаем на «Продолжить» и «Готово».

Настройка профиля

В верхней части мессенджера есть три раздела. Тот, что со значком в виде компаса, отвечает за различные настройки. Зайдите в него и выберите «Профиль». Здесь пользователь может изменить свой аватар, фон профиля, поменять имя, пол, а также ввести дату своего рождения.

Результат

QQ International — удобный мессенджер для общения. Процесс регистрации не займет много времени, если не делать ошибок.Самая распространенная ошибка — получение кода подтверждения дважды. Чтобы не нарваться на него, нужно дождаться прихода первого сообщения, и не нажимать «отправить еще раз», если после отправки прошло менее пяти минут.

QQ — популярный китайский мессенджер для бесплатного общения.

Возможности

QQ мало чем отличается от привычных современному пользователю мессенджеров, однако имеет ряд своих особенностей, о которых мы поговорим далее.Среди основных функций можно перечислить бесплатный обмен текстовыми сообщениями при подключении к сети — как в приватном режиме, так и в групповых беседах, а также создание видеоконференций. Пользователь может добавлять новые контакты в список существующих контактов, распределяя их по разным группам, а также управлять личным статусом, который виден людям из списка контактов.

Интересные особенности QQ, нетипичные для мессенджеров, включают встроенный переводчик, упрощающий общение с иностранными собеседниками, а также встроенный модуль AppBox, позволяющий использовать различные «фишки» вроде запуска игр или прослушивания интернет-радиостанций прямо в окно программы.

Международная версия QQ позволяет одновременно запускать несколько окон с разными учетными записями, а также предлагает 1 ГБ свободного места в «облаке» для хранения личных файлов пользователя.

Версии

Как упоминалось ранее, клиент QQ имеет несколько версий. Главный, конечно же, предлагает китайский интерфейс. Считается, что он достаточно интуитивно понятен и поэтому пользователь без труда разберется, как взаимодействовать с мессенджером. Если у вас не получилось, вы можете скачать International, правда, чтобы им пользоваться, нужно хотя бы немного понимать английский — на русский он тоже не переведен.Кстати, эта версия имеет несколько более ограниченный функционал, чем основная.

Основные характеристики

  • гибкое управление списком контактов;
  • общение в текстовом и видео формате;
  • возможность расширения функционала с помощью AppBox;
  • встроенный переводчик для общения с иностранцами;
  • одновременный запуск нескольких аккаунтов в двух окнах;
  • бесплатное распространение;
  • для работы с мессенджером необходима регистрация через номер телефона.

Время от времени мне приходят просьбы от друзей подсказать, как зарегистрироваться в китайском мессенджере QQ.
Некоторые программы предоставляют свой интерфейс для регистрации, но это не наш случай. К тому же регистрация сама по себе не представляет сложности. Самое сложное для человека, не знающего китайский язык, — задать секретные вопросы, что избавляет его от навязчивых напоминаний в мессенджере.

Итак, начнем.

регистрация
Регистрация по ссылке.qq.com и заполняем регистрационную форму:


В конце получаем номер.


Ничего сложного.
Теперь авторизируемся в мессенджере (рекомендуется использовать оригинальный клиент QQ в связи с тем, что китайцы [а мы собираемся с QQ общаться с ними?] привыкли использовать его возможности, которые не отображаются в других клиентах ). Мы получаем сообщения от самих себя. Пройдите по ссылке в этом письме.

Установка контрольных вопросов
Перейдя по ссылке, вводим число с паролем и видим следующую картинку:


Выбираем первый пункт.В следующем окне нам нужно выбрать другие варианты из выпадающих списков, потому что значения по умолчанию что-то вроде «Выберите вариант контрольного вопроса». Вот что получилось в моем случае:


В первом вопросе ошибка, написанная справа, означает, что нам нужно ввести >=6 цифр.
На второй и третий вопросы ошибка говорит, что нужно ввести > 7 латинских букв.
Вероятно, у них какой-то другой способ восприятия чисел, потому что цифры, видимые между иероглифами, совсем не похожи на «6» и «7» 🙂
Правая кнопка — «Вперед».Слева — «Назад».
Вперед:


Хитрая китайская капча 🙂 Теперь секретные вопросы представлены в виде картинок и смешаны. Ответим на них еще раз.
Если все ОК — вопросы заданы и подтверждение этому мы получаем на следующей странице, на которой для выхода из режима настроек защиты нажимаем левую кнопку.

Теперь вас больше не будет беспокоить бот QQ по поводу незащищенности аккаунта и вы сможете спокойно общаться с китайцами, которые сами прилипают к вам, когда видят в профиле «Россия» 🙂

УПД. Спасибо alexsx06 за наводку — бот больше не стучит и предлагает пройти жуткий квест по защите аккаунта 🙂 Но может кто столкнется со всем ужасом китайских форм и эта статья ему поможет =)

QQ International — интернет-мессенджер, особенно популярный в Китае. Программа поддерживает надстройки и позволяет общаться в текстовых и видеочатах. В целом функционал QQ International довольно схож с другими мессенджерами — пользователи этого приложения могут добавлять новые контакты, распределять их по группам, менять свой онлайн-статус, общаться в режиме конференции, а также запускать различные игры, утилиты и сервисы с помощью встроенный модуль App Box.(например, вы можете слушать интернет-радио прямо в окне QQ International). Программа позволяет переводить тексты с одного языка на другой — это может быть полезно, например, если вы общаетесь с человеком из другой страны. Пользователи QQ International могут запускать несколько копий программы, одновременно входя сразу в несколько учетных записей (при этом для каждого окна QQ International можно указать свою цветовую тему — чтобы не запутаться). QQ International поддерживает автозапуск и может быть свернута в системный трей.Каждый пользователь программы получает 1 Гб места в онлайн-сервисе облачного хранения.

Основные характеристики и функции

  • поддержка текстовых чатов;
  • поддержка видеочата
  • ;
  • возможность перевода текстов;
  • возможность установки дополнительного ПО, расширяющего функционал программы;
  • возможность одновременного запуска нескольких копий программы и использования нескольких учетных записей.

Схемы сенсорных выключателей света.Сенсорный переключатель на двух транзисторах


Простейшее сенсорное устройство можно собрать из нескольких доступных предметов. Там всего три транзистора, три резистора и один светодиод, вот и все. Можно даже схему собрать по вложению, все будет работать.


Транзисторы Любые конструкции NPN: CT315, CT3102 или BC547 или любые другие. Резисторы 0,125-0,25 Вт. Светодиод любого цвета, но лучше красный, так как падение напряжения минимальное.Питание 5 вольт, больше меньше может быть и меньше.

Все компоненты были компактно соединены между собой на миниатюрной печатной плате, что можно сделать просто вырезав лишнюю медную фрезу оставив таким образом остроконечные многоугольники. Детали б/у для поверхностного монтажа, транзисторы в СОТ-26 НПН, резисторы 0805, перемычки — куски проволоки, вместо них, если брать большие резисторы 2512 с нулевым (условным) сопротивлением. Сенсорное устройство работает сразу, без настройки.

Пояснение работы схемы

Доливом к базе транзистора Q3 вы открываете его, в результате чего через его КЭ и резистор 1 МОм протекает ток, который открывает следующий полупроводник Q2, он открывает Q3, который уже управляет светодиодом, открывает через него потоки КАТЭ, от минуса идет к катоду светодиода, а он уже подключен к аноду. Резистор 220 Ом здесь «ток-ревиантный», на нем падает лишнее напряжение, что предохраняет диод от деградации кристалла и полного выхода из строя LED1

Приложение

Ну и горит светодиод от касания пальца — и что? А дело в том, что вместо этого светодиода поставили реле и теперь мы можем управлять практически любой нагрузкой, в зависимости от характеристик применяемого реле.Ставим мощную лампу накаливания, подключенную к сети, а в разрыв этой цепи контакты реле. Теперь при нажатии, а точнее касании сенсора светится лампочка.

Так же можно организовать включение/отключение нагрузки с помощью оптопары если нет реле то тоже будет гальваническая развязка. Эта красивая штука состоит из светодиода и фототранзистора, когда первый светится, он открывает транзистор и через его СЕ может течь ток. Включите нужные выводы оптрона в цепь датчика вместо светодиода LED1, а два других в блок питания блока питания и любой нагрузки.Этот пункт может сниматься с зарядки от телефона. Возьмем, к примеру, ПК-17Л1.

Низко ниже вы видите дополнение к основной схеме, где показано подключение к оптрону на схеме датчика, так же добавлен один транзистор, это нужно для того, чтобы можно было подключить увесистую нагрузку, и не только светодиоды на 20 мА.

Подробнее Вместо реле и оптронов можно использовать два транзистора NPN. Я сделал это, вы видите схему. Работает это так: Q5 всегда должен быть разомкнут, через резистор 10 ком, но через КЭ Open Q4, «минус» приходит на базу Q5 и потому он замкнут.При прикосновении к датчику — то минус идет через открытый Q1 на базу Q4 и замыкает его, теперь ничто не мешает Q5 оставаться открытым — нагрузка работает, и в моем случае ярко светит мощный светодиод на 1 ватт.

Так он выглядит в собранном виде.

Датчик не имеет фиксации, дотронулся — светится, отпустил — не светит. Если хотите сделать фиксацию — просто добавьте в схему триггер, например, на микросхеме КМ555ТМ2 или любой другой (можно даже на таймере 555 реализовать).С добавлением триггерной системы при прикосновении к датчику нагрузка будет включаться до следующего прикосновения или включения питания цепи.

На практике может применяться для быстрого включения и выключения освещения в помещении. Очень удобно, коснулся небольшой чувствительной области, и комната освещена, второе касание выключит свет. Небольшое количество энергии будет потеряно, но этим можно пренебречь.

Комментарии

Схема работает, но в силу своей простоты не идеальна.Если датчик большой, то схема может сработать только тогда, когда вы его еще не трогали, тоже если поднести руку с волосами возле светодиода датчика тоже может загореться. Выход из этой ситуации простой — миниатюрный сенсорный датчик.

Как уже было сказано — обнаружение Q3 происходит за счет печати, на видео это видно, светодиод светит не постоянно, а подмигивает с высокой частотой, но при съемке это хорошо заметно.

Яркость рабочего диода не велика если прикоснуться только к базе третьего транзистора, но стоит прикоснуться и к плюсовому питанию, твоё тело выполнит в роликах резистора и транзистора Q3 войдет в насыщение.Но при такой ситуации смысл датчика для некоторых теряется.

Эта схема очень проста и предназначена только для понимания принципа работы.

Сегодня тачпады Вводы встречаются повсеместно. Их устанавливают на дисплеи смартфонов и планшетов, тачпады ноутбуков, графические планшеты, платежные терминалы и банкоматы, а также медицинское и промышленное оборудование. Производители делают сенсорные моноблоки и телевизоры, но большинство дисплеев ПК до сих пор нечувствительны к прикосновениям.

О том, как сделать обычный монитор — на ощупь многие, наверное, думали. Ведь в некоторых операциях (чтение, работа с графикой, редактирование текстов) ударить по странице, выбрать нужный пункт или выделить область на экране ручкой или пальцем гораздо проще, быстрее и удобнее, чем водить курсором или крутить. колесо мыши. На первый взгляд кажется, что эта затея фантастическая, и реализовать ее сложно. Но на самом деле все проще. Как сделать монитор сенсорным Alone — рассказывает этот материал.

Немного теории

Сенсорные поверхности экранов конструктивно представляют собой отдельный элемент, непосредственно связанный с матрицей дисплея. Конечно, в последних поколениях смартфонов и планшетов используются так называемые OGS-панели, в которых чувствительный элемент встраивается между пикселями, но все они равнозначны управлению. Существует три типа сенсорных экранов, каждый из которых имеет свои особенности.

Резистивный

Резистивная технология построения сенсорных экранов самая простая и дешевая.По принципу действия такие тачскрины родственны компьютерным клавиатурам. На двух слоях прозрачной подложки расположены дорожки из почти прозрачного токопроводящего материала. Эти два слоя расположены друг на друге с зазором в несколько микрометров. Верх обязательно гибкий и при касании пальцем становится замыкающим путем. Чем дальше расположена локация — тем больший путь проходит ток и тем выше сопротивление. По его значению (с точностью до Ома) контроллер датчика вычисляет, в каком месте произошло событие.

Резистивные сенсорные экраны Дешевые, простые, реагируют на любой предмет, но недостаточно надежны (вынуть тачскрин может выйти из строя при небольшом надрезе) и имеют ограниченную прозрачность (дорожки проводников также видны под определенным углом).

Емкостный

Емкостной тачскрин

самый распространенный в наше время (по состоянию на 2016 год). Он более совершенен и надежен. Количество слоев уменьшилось до одного, его толщина стала меньше. На поверхность сенсорного стекла или пленки нанесена сетка из прозрачных проводников, отличающихся малым сопротивлением.Тело человека не проводит электричество и может накапливать электрический заряд, поэтому при прикосновении пальца к стеклу происходит небольшая утечка тока, место которой определяет контроллер.

Волна

В волновом сенсорном экране для регистрации прикосновений используются акустические (ультразвук, технология поверхностно-активных веществ) или световые (инфракрасные, ультрафиолетовые, технология PSV) волны. По периметру экрана установлена ​​рамка, объединяющая излучатель и регистратор.Когда палец касается поверхности — он поглощает и частично отражает волну, а датчики фиксируют место.

.

Экраны ПАВ и ПСВ надежны, абсолютно прозрачны (отсутствуют сетчатые электроды), имеют неиссякаемый теоретический ресурс (в реальности зависит от качества комплектующих), при наличии защитного каркаса сам датчик невозможно повредить, и использование бронированного движителя делает неуязвимой и экранирующую матрицу. Поэтому их часто используют в банкоматах, платежных терминалах, промышленных машинах и медицинском оборудовании.А вот точность определения координат пальца посредственная. Также волновые тачскрины требуют регулярных протираний (грязь на стекле вызывает фантомные реакции).

Существуют и другие типы датчиков для дисплеев, но они наиболее распространены. Кроме того, эти способы сложно реализовать в домашних условиях, потому что они не учтены.

Применение датчиков на практике

Применительно к сенсорным мониторам востребованы все три технологии. Резистивный тип широко применялся ранее, но встречается и сейчас.Именно его интересуют сроки, но о нем чуть ниже. Емкостные датчики применяются практически во всех современных дисплеях, изначально сенсорных. Сенсорные экраны Wave, как было сказано выше, используются в банковском, промышленном, медицинском и другом специфическом оборудовании. Благодаря предприимчивым китайцам они тоже интересны при переделке обычного монитора на ощупь.

Сразу стоит отметить, что исчезает ремиссия обычного монитора на сенсорную емкостность: такой тач относительно дорог, специфичен и отдельно не встречается.Но гораздо интереснее в этом плане резистивные и волновые технологии. Также стоит упомянуть чисто световой (не на ПСВ, а инфракрасный) вариант.

Способ 1: легкий

Первый способ самый простой и доступный, но требует определенных навыков и желания работать. Перед тем, как сделать монитор сенсорным, необходимо запастись камерой с инфракрасной веб-камерой (как в ТВ-панели), куском пленки (неизготовленной), аккумулятором и корпусом для самодельного стилуса (например, лазерной указки), а также а также программа Community Core Vision.Что со всем этим добром делать — пункты ниже.


Перед тем, как сделать обычный монитор сенсорным по этому методу, необходимо убедиться, что уровень технических навыков достаточен, а обстановка не мешает воплощению идеи. Ведь веб-камера требуется для точного позиционирования, а для этого нужно место на столе, которого не все. Кроме того, небольшое смещение ее или экрана заставляет заново все настраивать.

Способ дешевле: из оборудования купить только самую дешевую камеру рублей за 500 (большинство и так есть в наличии), ИК-диод (можно вытащить из сломанного пульта), лазерную указку (можно взять маркер или другой тонкий трубка вместо нее), батарейки («мини-пальчики» или «таблетки»).Самое сложное с фильмом: Большинство людей фильм «Мыло» последний раз держали в руках более 10 лет назад. Кроме того, из недостатков метода – сложность настройки, неустойчивость конструкции, не самый высокий уровень удобства.

Некоторые китайские производители предлагают готовые решения этого типа, позволяющие сделать монитор сенсорным. Такие изделия представляют собой специальную широкоугольную веб-камеру, закрепленную на дисплее и стилусе. Этот вариант не лишен упомянутых недостатков, но выглядит привлекательно и не требует навыков работы с самоделками.

Метод 2: волна

Существуют готовые сенсорные панели, работающие по принципу поверхностно-световых (ПСВ) и поверхностно-акустических (ПАВ) волн. Они представляют собой стекло с рамкой, к которой подключается специальный контроллер с интерфейсом USB или COM (RS-232). Такие решения предназначены в первую очередь для создания терминалов и специального оборудования, но никто не запрещает использовать их дома.

Процесс переделки дисплея с их помощью предельно прост.

  1. Перед тем, как сделать монитор сенсорным, необходимо протереть его микрофиброй со специальным чистящим средством или универсальным дворником. Важно помнить: если экран имеет антибликовое покрытие — пользоваться нельзя для этого средства содержащие аммиак (аммиак), так как смывают этот слой!
  2. После этого на экран накладывается сенсорное стекло, которое закреплено в комплекте креплений или скреплено на качественном двухстороннем приклеивании (но все же лучше прикрутить).
  3. Дальнейшая процедура настройки заключается в установке фирменного драйвера и другого ПО (поставляется на диске с датчиком или скачивается с сайта производителя) и калибровке тачскрина.

Основным недостатком такой переделки монитора в сенсорный является относительная дороговизна. Новый сенсор стоит от нескольких тысяч до десятков тысяч рублей в зависимости от диагонали. К тому же найти нужный размер на современных широкоформатных матрицах часто бывает сложно, найти большую диагональ.Это связано с тем, что узкоформатные (4:5 или 3:4) экраны имеют наилучшее соотношение диагонали и полезной площади, поэтому такие тачскрины выпускаются чаще. Кроме того, стекло с рамкой может испортить эстетический вид монитора, не вписываясь в его внешний вид.

Метод 3: резистивный

С точки зрения цены, эффективности и удобства использования резистивный сенсорный экран наиболее предпочтителен. Китайские производители создают специальные сенсорные пленки разного уровня точности, прочности и функциональности, с разными размерами.

Некоторые из них можно обрезать под размеры дисплея, другие не поддерживают такую ​​модификацию. Поэтому перед покупкой такого тачскрина необходимо изучить его описание и характеристики.

  1. Перед тем, как штатный монитор сделать тач, его тоже нужно протирать от пыли и разводов.
  2. Далее следует снять переднюю рамку с экрана (обычно это делается с помощью посредника, ненужной банковской карты или другого тонкого предмета из прочного пластика, который вставляется в зазор) и еще раз протереть дисплей микрофиброй.
  3. Если тачскрин не подходит, но поддерживает обрезку — нужно снимать мерки с матрицы, чтобы подогнать к ней сенсор. Делать это необходимо в соответствии с инструкцией производителя датчика. Также рекомендуется посмотреть видео конструкцию по разборке дисплея, чтобы не сломать его. Наконец, важно помнить: модификация лишит вас гарантии производителя дисплея.
  4. По краям матрицы монитора (за пределами видимой области) нужно наклеить специальные прокладки, на которые будет подсаживаться тач.Это необходимо для защиты дисплея от давления пальцев во время работы.
  5. Далее необходимо расположить датчик и наклеить его на матрицу.
  6. Чтобы скрыть контроллер тачскрина и закрепить его, необходимо снять заднюю крышку монитора. Для этого нужно отсоединить ножку или подставку, открутить винты сзади (если есть).
  7. Возле платы скалера (контроллера матрицы) желательно найти свободное место, куда контроллер будет посажен на винт или двусторонний скотч (первый вариант).
  8. Кабель питания контроллера и передачи данных необходимо вывести в имеющееся отверстие возле разъема VGA/HDMI/DVI или другого интерфейса подключения. Если отверстий нет — это можно сделать дрелью или горячим гвоздем (диаметр подбирать по толщине шнура).
  9. При установке контроллера важно следить за целостностью шлейфа, не допуская его перекручивания, острых заеданий и т.п.
  10. Если матрица находится вплотную в корпусе монитора — в том месте, где шлейф будет ехать назад, лучше сделать на корпусе отжим наждачной бумагой, собственно, или горячим ножом для снятия слоя пластика.
  11. Затем заднюю часть Чехлы можно поставить обратно.
  12. Чтобы рамка монитора вернулась, ее придется модифицировать. В зависимости от особенностей конструкции придется подрезать крепеж, подрезать или немного подогнуть внутренние стороны и т. д. После подгонки можно будет установить.
  13. Заключительный этап — Подключение датчика и его калибровка. Для этого нужно установить драйвер (скачивается с сайта производителя датчика или идет в комплекте с ведром), а затем настраивать точность, касаясь точек, которые выводит программа-драйвер.

Предлагаю собрать интересную радиолюбительскую конструкцию, которую легко повторить даже начало своими руками. Этот сенсорный выключатель, схема которого приведена ниже, можно использовать в различных ситуациях. В сенсорных устройствах хоть и нет гальваники с электросетью, но они полностью безопасны и не нанесут вреда здоровью человека

Принцип работы схемы заключается в том, что как только биологический объект попадает в зону действия датчика, включается свет.Если он покинет зону контроля ИК-датчика, то освещение устройства выключится через заданный интервал времени.

В момент включения напряжения схемы счетчик CD4040 находится в состоянии сброса и на его выходе логический ноль, а на выходе инверторного элемента или блока не-DD1.6, а транзистор — открыт, а реле с нормально замкнутыми контактами шунтирует кнопку выключателя.

Для работы инфракрасного датчика используется на элементах или нет DD1.1 и DD1.2. Для применяемого фотоприемника выбрана частота импульсов 36 кГц. Если использовать другой, то для него нужно будет настроить генератор на частоту, на которую рассчитан фотоприемник.

Для увеличения импульсного тока, поступающего от генератора на инфракрасный светодиод HL2, применен усилитель на элементах DD1.3 и DD1.4. Особенность фотодатчика заключается в том, что при введении модулированного ИК-излучения на его выходе будет установлен сигнал логического нуля.

Проходя через инвертирующий элемент DD1.5, на одиннадцатом выходе счетчика появится логическая единица, которая его запретит. Если отраженный луч не попадет на фотоприемник, то этот же вход будет логическим нулем, и счетчик начнет считать импульсы, поступающие на десятый вход от мигающего светодиода HL1.

Элементы схемы подобраны таким образом, что через двадцать минут работы, если в зоне доступа датчика биологического объекта не наблюдается, на выходе будет установлена ​​логическая единица, а на выходе ДД1.6 элемент. В этом случае транзистор выключит реле К1 и освещение.

При включении схемы переводит триггер в одно из устойчивых состояний и включает свет при первом повороте сенсора касания к сенсору, при повторном включении триггер переводит триггер в противоположное состояние и тем самым выключает освещение.

Длительность срабатывания триггера в любом состоянии не устанавливается, пока на схему не будет подано напряжение.

Триггер подключен по типовой схеме для микросхемы К561ТМ.С первого выпуска микросхемы сигнал управления поступает на усилитель тока, выполненный на биполярном транзисторе. Выход управления тиристором подключен к эмидеру этого транзистора и при достижении на нем уровня напряжения тиристор откроется, и включится свет.

Т.к. полевой транзистор имеет большее сопротивление перехода сток-исток-затвор, плюс в цепи датчика стоят мегом резисторы, он не допустит опасного потенциала на сенсорной пластине.Полевой транзистор откроется под действием напряжения питания, которое наводится датчиком руки. Резистор R3 шунтирует вход 3 триггера. Триггер переключается при каждом положительном сигнале на третьем входе. Если на первом выходе триггера логический ноль, биполярный транзистор закрывается и освещение отключается. Когда появляется логическая единица, транзистор и тиристор открыты, а лампочка горит.

Датчик может быть изготовлен из любого металла диаметром не менее 30 мм. Данная схема обеспечивает включение и выключение питания мощностью не более 60Вт.Для большей мощности тиристор нужно будет установить на радиатор.

Вы можете управлять светом двумя способами. Во-первых, поднесите руку к оптическому датчику на десять сантиметров. Во-вторых, с помощью пульта дистанционного управления ИК-излучением.



Реле можно брать практически любые, главное чтобы напряжение срабатывания проводилось в диапазоне от 6 до 12 вольт. Датчик представляет собой кусок фольгированного текстолита. Оба транзистора можно заменить на КТ315 или КТ3102. Любой импульсный диод на напряжение от 100 вольт можно взять и .

Схема работает как усилитель сигнала — при прикосновении к датчику за счет внутреннего сопротивления человека открывается VT1, а за ним и VT2 срабатывает реле и замыкает цепь в которую впринципе можно подключить любую нагрузку( видеть). Контакты реле служат переключателем, один из выводов этих контактов подключается к сети 220, а другой к нагрузке, например лампам освещения.

Выключатель подходит для сенсорного управления любой нагрузкой, практически независимо от мощности.В случае низковольтного питания блока питания реле можно исключить, а второй транзистор заменить на более мощный, например КТ819.

Универсальный таймер предназначен для генерации повторяющихся и одиночных импульсов со стабильными временными характеристиками.

NE555 B. этот вариант Работает в режиме компаратора. При прикосновении к сенсорной пластине произойдет переключение компаратора, выход которого подключен к двум светодиодам. Поскольку максимальный ток NE555 составляет 200 мА, вместо светодиодов можно подключить реле для управления нагрузкой.Напряжение питания конструкции может быть в пределах от 5 до 15 вольт.

Электромагнитные помехи могут нарушить работу сотовых телефонов и ухудшить качество приема сигнала. Но они могут стать ключом к трансформации традиционных ЖК-дисплеев в с жестовым управлением.

Группа исследователей из компьютерной лаборатории Университета Вашингтона разработала метод преобразования обычного жидкокристаллического дисплея (ЖК) в сенсорный экран методом электромагнитных помех.Технология Utouch подразумевает использование простого сенсора и программного обеспечения. В основе этой технологии лежит слабое электромагнитное излучение, источником которого является бытовая электроника.

«Устройства вокруг нас являются источником всех этих сигналов. Но люди не придают им значения, потому что воспринимают их как сигналы тревоги», — говорит исследователь и соавтор Сидхант Гупта.

Если для планшетных компьютеров и смартфонов сенсорные экраны успели стать нормой, то в телевизионных панелях и компьютерных мониторах они только начинают получать распространение.

Существующие способы преобразования пассивных дисплеев в сенсорные экраны, как правило, основаны на камерах или других датчиках. Однако такое решение не всегда практично. Результаты последнего исследования будут представлены в рамках майской научной конференции в Париже, где будут обсуждаться вопросы взаимодействия человека и компьютера.

Авторы исследования отмечают, что они измерили и проанализировали характер сигналов, поступающих с ЖК-дисплеев при обращении к экрану руки. Эти сигналы регистрируются как электромагнитные помехи, и их измерение можно производить с помощью 5-долларового датчика, подключенного к домашней розетке.

Датчик собирал информацию об электромагнитных помехах и отправлял ее на компьютер, подключенный к системе со специальным программным обеспечением. Программа использовала метод машинного обучения для прогнозирования сигнала, который распознается как шум или как один из пяти установленных жестов. После регистрации прикосновения или жеста экран выполнял команду пользователя.

«Мы пытаемся лучше понять характер изменения сигнала, его интенсивность», — говорит Гупта.

Каждый дисплей создает собственные электромагнитные помехи.Датчик способен видеть разницу между ними. Это позволяет научить обычные жидкокристаллические дисплеи распознавать прикосновения и жесты.

Но у технологии Utouch есть свои ограничения. Этим методом нельзя превратить обычный дисплей в интерактивный экран iPhone или смартфона. Устройство реагирует на незамысловатые жесты, которые проигрывают видео, запускают и останавливают приложения. Более сложные движения кончиков пальцев по экрану пока непонятны.

Исследователи не планируют коммерциализацию технологии, но, по словам Гупты, необходимые компоненты имеются в свободной продаже, а в отчете рассмотрены все алгоритмы.Поэтому при желании систему можно собрать самостоятельно.

Команда продолжит работу над улучшением технологии Utouch.

«Умирающий» рынок ПК можно спасти.

Доставка доставки и трек

Китайцы дали мне странный трек UA ****** YP. Сначала подумал, что товар ошибочно отправили в Украину, как написал продавец.
Продавец заверил, что с отправкой все в порядке. Что у них новая логистика для ускорения доставки и что эти треки можно отследить по адресам
или
Но эти сайты ничего не сказали в моем треке 🙁

Симистор Перепания — минутное дело

У меня было немного по другому разогреть электролитические конденсаторы, так как один касался корпуса симистора.А у него BT137, увы, не изолированный.

Включаю — все работает как часы. В итоге получаю сенсорный выключатель «1-Way 5a» на китайской градуировке ;)))
На самом деле симистор в корпусе TW 220 без радиатора может коммутировать 150-200Вт.

А кто мешает симистор на радиаторе. Например радиатор 25см2 позволяет коммутировать уже 800Вт, если полная нагрузка этого симистора 8 стандартных (не китайских ампер)?
А для того, чтобы на радиаторе не было высокого напряжения, он крепится к сормистору на такие штуки — пластиковые изоляторы под винт и силиконовые прокладки:


которые продаются по копейке по 50-100 шт


— 1$.42/100
— 0,99$/100

Ну или по старинке на пластинках со слюной.

Итак коммутаторы пришли, были успешно модернизированы и запущены в работу.

В активе осталось 5 б/у Mac97 маломощных симисторов и пара 3-х полосных переключателей на китайские 3А.

Долго изучал печатные платы Переключатели.


К сожалению, перемычек, задающих режим работы «1-Way/3-Way» не нашел. Видимо разные чипы «черные кляксы» или их прошивки, если это ПЛК.

Подведем итоги

Достоинства:
— Работает без нареканий (если сразу не сгорит по мощности)
— Низкая цена
— Небольшие габариты
— Простое подключение
— подлежит апгрейду для увеличения нужной мощности
Недостатки :
— максимальный ток коммутации значительно меньше заявленного
— очень комбайны

Датчик не реагирует на кошку, но крайне недоволен экспериментом

Toyota Corolla 100 кузов: описание, размеры, отзывы

Все транспортные средства: как легковые, так и грузовые, автобусы имеют свои габаритные размеры.Это одна из важнейших характеристик автомобиля. В этой статье рассмотрим размеры и характеристики кузова Тойота Королла 100 с отзывами автомобилистов.

Преобразования

На протяжении многих лет представители Toyota Corolla работали над изменением как экстерьера, так и типа кузова, технического оснащения и основных габаритов. Поэтому автомобиль изменился в длину, ширину и высоту.

При характеристике изменений кузова Тойота Королла 100 следует учитывать тип используемого кузова, характеристики подвески автомобиля и тип привода (полный или передний).

Особенности модельного ряда

Модельный ряд Тойота в современном исполнении (с 2000 года) существенно отличается габаритами:

  • Королла Е-120 — пятиместная модель, тип кузова которой — седан, бывшая в производство с 2000 года. Автомобиль отличается следующими параметрами: длина – 4364 мм, ширина – 1694 мм и высота – 1469 мм при дорожном просвете 16,0 см.
  • Corolla Fielder — с пятью дверями и таким же количеством мест, версия универсал выпускается с 2001 года.Габариты машины: длина — 4409 мм, ширина — 1694 мм и высота — 1521 мм. Обновленная в 2008 году модификация тяготеет к названию Fielder CVT. При длине кузова 4420 мм эта модель не так уж и велика по высоте: 1480 мм — переднеприводная комплектация и 1491 мм — полноприводная.
  • При клиренсе автомобиля от 16,0 до 15,5 см очередное переиздание Филдера характеризуется еще более короткими (4360 мм) и низкими (1470 мм для переднего привода) размерами автомобиля.
  • Полноприводный седан повышает проходимость и становится похожим на Luxel 2002 года.Оба автомобиля имеют одинаковую длину, ширину и высоту: 4390 мм, 1694 мм и 1480 мм при клиренсе 17,0 см.
  • Corolla G 1.5 также была выпущена в 2002 году и представляет собой переднеприводный четырехдверный седан длиной 4390 мм, шириной 1694 мм и высотой 1469 мм.

  • Sportivo — хэтчбек, появившийся в 2003 году в серийном производстве. Этот переднеприводный пятидверный хэтчбек имеет пять посадочных мест. При габаритных параметрах: 4176 мм в длину, 1694 мм в ширину и 1469 мм в высоту следующая модель хэтчбека Verso имеет длину 4370 мм, ширину 1770 мм и высоту 1620 мм.
  • 2006 г. — начало серийного производства еще одного представителя семейства Corolla — Д-4 Д 125, пятиместного четырехдверного седана, имеющего передний привод, кузов длиной 4540 мм, шириной 1760 мм и высотой 1470 мм. В этом же году стартовал выпуск седана 1.4 VVT-I, габариты модели идентичны.
  • Еще один седан 2006 года — XRS, в виде четырехдверной пятиместной модели автомобиля, длина которой составляет 4529 мм, ширина — 1699 мм, а высота — 1475 мм.В этой модели дорожный просвет составляет 14,5 см. 2009 год – время рестайлинга модели и изменения ее габаритов: она увеличилась в длину до 4538 мм, стала 1761 мм в ширину и увеличилась в высоту до 1467 мм. Также следует отметить уменьшение клиренса до 13,5 см.
  • Altis 2007 года выпуска представляет собой вариант седана с 1,6-литровым двигателем, четырехдверным и пятиместным. Начато производство с размерами длины — 4540 мм, ширины — 1761 мм и высоты — 1465 мм; Дорожный просвет 15,5 см

  • Rumion 1 2007 года.5G — переднеприводный автомобиль с кузовом хэтчбек и пятью посадочными местами. «Румион» по параметрам составляет 4210 мм в длину, 1760 мм в ширину и 1630 мм в высоту, при клиренсе 13,5 см. В это же время начат выпуск полноприводной версии, более высокой и с увеличенным дорожным просветом, до 1641 и 14 мм.
  • S — переднеприводная пятиместная модель седан, с четырьмя дверями, 2010 модельного года. Кузов модели характеризуется наличием таких габаритов: длина — 4553 мм, ширина — 1764 мм при высоте 1467 мм и дорожный просвет 14.7 см.
  • 2012 — запуск переднеприводного пятидверного хэтча CVT. Автомобиль имеет тип кузова в виде хэтчбека, с пятью посадочными местами. Эта машина отличается меньшими габаритами: 4274 против 1761 и 1461 мм.
  • 2013 год — начало серийного производства Corolla 11-го поколения с габаритами в длину и ширину: 4639 на 1776 мм и достаточно низкой посадкой 1455 мм, дорожным просветом 15 см.

Из предоставленного описания модельного ряда Toyota можно сделать вывод, что все автомобили отличаются разной формой кузова, количеством дверей, мест для посадки может быть четыре или пять.Причина этого в том, что габаритные размеры модельного ряда достаточно разнообразны. Чтобы «Корола» лучше чувствовала себя в условиях российских дорог, ее рекомендуется тюнинговать, поднимая подвеску.



Знакомство с «Королём»

Toyota Corolla является самым продаваемым автомобилем в мире, а в общей сложности состоит из 11 поколений автомобилей, начало производства которых началось в 1966 году.

Последнее 12 поколение 2018 года на Международном автосалоне в Женеве был представлен под значком Auris, а теперь он выглядит так, будто японский бренд представлен в обновленном формате хэтчбека.

Основными показателями «Королей» являются:

  • внешний вид;
  • невероятное количество технологий;
  • спортивная установка шасси;
  • Стандартная шестиступенчатая механическая коробка передач.

Первые модели

Стандартная линейка Corolla включала трехдверный хэтчбек Corolla FX, четырехдверный седан и пятидверный универсал (и легкий фургон). Также было двухдверное купе Corolla Levin. Полноприводный седан и универсал также были доступны с двигателем 1.6-литровый бензиновый или 2,0-литровый дизельный двигатель.

«Король» 100

Кузов Toyota Corolla 100 вариация:

  • 4-дверный седан;
  • 3/5-дверный хэтчбек;
  • 2-дверное купе;
  • 3/5-дверный подъемник;
  • 5-дверный универсал

Двигатель может работать на бензине:

  • 1,3 л 2E I4;
  • 1,3 л 4E-FE I4;
  • 1,5 л 5A-FE I4;
  • 1,6 л 4A-FE I4;
  • 1,6 л 4A-GE I4;
  • 1.6 л 4A-GZE I4;
  • 1,8 л 7A-FE I4

Также Toyota Corolla 100, кузов которой имеет несколько вариантов, может работать на дизельном топливе и быть:

  • 2,0 л 2 CI 4;
  • 2,2 л 3C-E I4.

Коробки передач:

  • 4/5/6-ступенчатая механическая;
  • 3/4 скорости автомат.

«Король» 1992 года

В 1992 году были представлены четырехдверная Corolla Ceres и четырехдверный Sprinter Marino. Они не отличались реальной внешней схожестью, но не были похожи по ходовой части и большей частью по гамме двигателей от стандартных Королл.Использовалась приборная панель Levin/Trueno. Незначительные изменения были внесены в мае 1993 года. Они включали новую решетку радиатора, реконфигурацию задних фонарей и различные другие части отделки и гарнира.


Размеры Toyota Corolla 100 100 1992 года следующие:

  • Колесная база 97,0 дюймов (2,464 мм).
  • Длина 172,0 дюйма (4,369 мм).
  • Ширина 66,3 дюйма (1,684 мм).
  • 1052 кг (2315 фунтов) снаряженной массы.

Corolla e100

Предшественница модели — Corolla E90, а преемница — Corolla E110.

Corolla E100 — седьмое поколение автомобилей, продаваемых Toyota под шильдиком Corolla. Это поколение Corolla было больше, тяжелее и визуально более аэродинамичным, чем модель, которую оно заменило. С колесной базой 2465 мм (97 дюймов) Corolla перешла в класс компактных размеров, когда-то занимаемый Crown и Camry. У Corolla была эквивалентная модель Sprinter, а у Sprinter Trueno был эквивалент Corolla Levin и две эксклюзивные модели от японских дилеров Toyota Vista Store.

Увеличилась не только колесная база, но и дизайн, как у «мини-Лексуса» из флагманского модельного ряда Toyota.Седан и хэтчбек имеют коэффициент аэродинамического сопротивления Cd = 0,33, лифтинг — Cd = 0,30, а универсал/фургон — Cd = 0,36.

В моделях серии 100 использовалось меньше панелей кузова, чем в их предшественниках, чтобы повысить прочность, снизить стоимость и уменьшить зазоры между панелями (что обеспечивает более чистый вид и меньшее сопротивление ветру). Фары теперь сделаны из поликарбоната, а не из стекла.



Обзор Обзор

Кузов Toyota Corolla Отзывы показывают, что универсал Toyota Corolla уже давно является выбором для небольших семей и предприятий.В Японии эта модель называется Fielder и остается отдельной моделью для остальной части модельного ряда Corolla. Полный привод также является распространенным вариантом.

Кузов Toyota Corolla 100 7-го поколения похож на фургон Corolla с мягкой и закругленной передней частью, большими фарами, высокими прямыми бортами и квадратным задним сиденьем. Эта модель оснащена легкосплавными дисками, рейлингами на крыше и хромированной отделкой, которые обычно встречаются на большинстве полевых машин. Также очень распространены тонированные стекла — они помогают пассажирам сохранять прохладу и груз от посторонних глаз.На задней двери нет значка Corolla, только Fielder.

Пользователи отмечают, что, как и у версии RunX, передние сиденья слишком короткие, не рассчитаны на более высоких водителей. Заднее сиденье шире — для двоих взрослых и ребенка. Места для ног и над головой очень много для автомобиля такого размера.

Toyota Corolla является самым продаваемым легковым автомобилем в стране и за рубежом, достигнув 45 миллионов автомобилей по всему миру с момента своего первого появления на автомобильном рынке.



Варианты тюнинга

Тюнинг кузова Toyota Corolla 100 может заключаться в замене переднего бампера.Это позволит добиться изменения внешнего вида автомобиля, сгладив углы кузова.

Увеличенные воздухозаборники будут отлично смотреться. Это будет способствовать лучшему охлаждению радиатора и тормозных колодок. Для этого используются запчасти на кузов Тойота Королла 100.

Заниматься установкой заднего бампера можно с помощью специального состава, который снабжен герметиком и клеем с последующей фиксацией на штатные крепления. Это поможет визуально уменьшить клиренс и придаст некоторую мощность задней части машины.

С помощью боковых накладок на пороге кузова достигается более спортивный и немного агрессивный вид кузова, габариты Toyota Corolla кажутся более внушительными.



Подведем итоги

Автомобиль «Тойота Королла» 100 пользуется широкой популярностью у автомобилистов. Он доступен в нескольких вариантах кузова. Отзывы об этом автомобиле позволяют сделать вывод, что машина заслуживает внимания. При желании вы можете тюнинговать это транспортное средство, чтобы машина больше соответствовала условиям отечественных дорог.Такие работы проводятся своими силами или с помощью специалистов в автосервисе.

Добавить комментарий

Ваш адрес email не будет опубликован.